Multiple sequence alignment - TraesCS2B01G611400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G611400 chr2B 100.000 2535 0 0 1 2535 790657874 790655340 0.000000e+00 4682.0
1 TraesCS2B01G611400 chr2B 94.696 2451 76 17 118 2535 790668270 790665841 0.000000e+00 3757.0
2 TraesCS2B01G611400 chr2B 99.027 1439 14 0 1 1439 790647355 790645917 0.000000e+00 2580.0
3 TraesCS2B01G611400 chr2B 96.122 1083 35 2 1451 2532 135086651 135087727 0.000000e+00 1760.0
4 TraesCS2B01G611400 chr2B 95.756 1084 35 3 1451 2532 752860906 752859832 0.000000e+00 1736.0
5 TraesCS2B01G611400 chr2B 95.500 1089 40 4 1449 2535 64097647 64096566 0.000000e+00 1731.0
6 TraesCS2B01G611400 chr2A 88.719 1507 102 34 1 1450 770254731 770256226 0.000000e+00 1779.0
7 TraesCS2B01G611400 chr2A 78.829 222 33 9 95 304 590731436 590731217 1.220000e-28 137.0
8 TraesCS2B01G611400 chr1B 96.122 1083 38 2 1451 2532 668106938 668108017 0.000000e+00 1764.0
9 TraesCS2B01G611400 chr1B 93.923 1086 41 8 1451 2535 22827617 22826556 0.000000e+00 1616.0
10 TraesCS2B01G611400 chr1B 77.778 162 28 6 85 239 268395063 268394903 2.690000e-15 93.5
11 TraesCS2B01G611400 chr1B 100.000 48 0 0 262 309 488479035 488479082 3.470000e-14 89.8
12 TraesCS2B01G611400 chr1B 98.000 50 1 0 262 311 625079428 625079477 1.250000e-13 87.9
13 TraesCS2B01G611400 chr1B 97.917 48 1 0 262 309 488478512 488478559 1.620000e-12 84.2
14 TraesCS2B01G611400 chr1B 97.917 48 1 0 262 309 503814465 503814512 1.620000e-12 84.2
15 TraesCS2B01G611400 chr7B 95.937 1083 35 1 1450 2532 150192987 150194060 0.000000e+00 1748.0
16 TraesCS2B01G611400 chr7B 95.760 1085 37 5 1451 2535 426362178 426361103 0.000000e+00 1740.0
17 TraesCS2B01G611400 chr5B 95.764 1086 40 1 1450 2535 129726639 129725560 0.000000e+00 1746.0
18 TraesCS2B01G611400 chr5B 75.096 261 31 12 57 309 94278411 94278177 9.660000e-15 91.6
19 TraesCS2B01G611400 chr5B 96.364 55 1 1 262 315 65968072 65968018 3.470000e-14 89.8
20 TraesCS2B01G611400 chr5B 94.643 56 2 1 262 316 261184014 261183959 4.490000e-13 86.1
21 TraesCS2B01G611400 chr2D 93.320 1033 40 6 443 1450 644896580 644897608 0.000000e+00 1498.0
22 TraesCS2B01G611400 chr2D 96.296 54 1 1 262 314 351377158 351377211 1.250000e-13 87.9
23 TraesCS2B01G611400 chr3D 80.687 233 34 9 83 309 519664087 519663860 1.210000e-38 171.0
24 TraesCS2B01G611400 chr3D 95.918 49 2 0 262 310 611379031 611378983 2.090000e-11 80.5
25 TraesCS2B01G611400 chr5D 78.395 162 25 7 83 239 25038458 25038614 2.080000e-16 97.1
26 TraesCS2B01G611400 chr5D 75.980 204 34 11 48 239 418944302 418944502 9.660000e-15 91.6
27 TraesCS2B01G611400 chr6B 92.063 63 3 2 262 323 88312395 88312334 1.250000e-13 87.9
28 TraesCS2B01G611400 chr4D 89.706 68 6 1 235 302 450216956 450216890 4.490000e-13 86.1
29 TraesCS2B01G611400 chr4D 79.646 113 19 4 170 282 50665114 50665006 7.520000e-11 78.7
30 TraesCS2B01G611400 chr4A 94.643 56 2 1 262 316 664232839 664232784 4.490000e-13 86.1
31 TraesCS2B01G611400 chrUn 97.917 48 1 0 262 309 75667977 75668024 1.620000e-12 84.2
32 TraesCS2B01G611400 chrUn 95.833 48 2 0 262 309 35731328 35731281 7.520000e-11 78.7
33 TraesCS2B01G611400 chrUn 95.833 48 2 0 262 309 35888981 35889028 7.520000e-11 78.7
34 TraesCS2B01G611400 chrUn 95.833 48 2 0 262 309 41894932 41894979 7.520000e-11 78.7
35 TraesCS2B01G611400 chrUn 95.833 48 2 0 262 309 242150983 242151030 7.520000e-11 78.7
36 TraesCS2B01G611400 chrUn 95.833 48 2 0 262 309 282653721 282653674 7.520000e-11 78.7
37 TraesCS2B01G611400 chrUn 95.833 48 2 0 262 309 450406600 450406553 7.520000e-11 78.7
38 TraesCS2B01G611400 chrUn 93.750 48 3 0 262 309 31679511 31679558 3.500000e-09 73.1
39 TraesCS2B01G611400 chr4B 97.917 48 1 0 262 309 72645003 72645050 1.620000e-12 84.2
40 TraesCS2B01G611400 chr4B 97.917 48 1 0 262 309 81937525 81937572 1.620000e-12 84.2
41 TraesCS2B01G611400 chr4B 94.545 55 2 1 262 315 482131214 482131268 1.620000e-12 84.2
42 TraesCS2B01G611400 chr4B 94.444 54 2 1 262 314 602778511 602778564 5.810000e-12 82.4
43 TraesCS2B01G611400 chr1A 97.917 48 1 0 262 309 568516684 568516637 1.620000e-12 84.2
44 TraesCS2B01G611400 chr1A 95.238 42 2 0 205 246 514773856 514773897 1.630000e-07 67.6
45 TraesCS2B01G611400 chr1A 95.238 42 2 0 205 246 515023742 515023783 1.630000e-07 67.6
46 TraesCS2B01G611400 chr6A 94.340 53 3 0 262 314 549245355 549245407 5.810000e-12 82.4
47 TraesCS2B01G611400 chr6D 97.826 46 1 0 262 307 427121426 427121471 2.090000e-11 80.5
48 TraesCS2B01G611400 chr6D 97.826 46 1 0 262 307 461506541 461506496 2.090000e-11 80.5
49 TraesCS2B01G611400 chr1D 97.826 46 1 0 262 307 359478532 359478577 2.090000e-11 80.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G611400 chr2B 790655340 790657874 2534 True 4682 4682 100.000 1 2535 1 chr2B.!!$R4 2534
1 TraesCS2B01G611400 chr2B 790665841 790668270 2429 True 3757 3757 94.696 118 2535 1 chr2B.!!$R5 2417
2 TraesCS2B01G611400 chr2B 790645917 790647355 1438 True 2580 2580 99.027 1 1439 1 chr2B.!!$R3 1438
3 TraesCS2B01G611400 chr2B 135086651 135087727 1076 False 1760 1760 96.122 1451 2532 1 chr2B.!!$F1 1081
4 TraesCS2B01G611400 chr2B 752859832 752860906 1074 True 1736 1736 95.756 1451 2532 1 chr2B.!!$R2 1081
5 TraesCS2B01G611400 chr2B 64096566 64097647 1081 True 1731 1731 95.500 1449 2535 1 chr2B.!!$R1 1086
6 TraesCS2B01G611400 chr2A 770254731 770256226 1495 False 1779 1779 88.719 1 1450 1 chr2A.!!$F1 1449
7 TraesCS2B01G611400 chr1B 668106938 668108017 1079 False 1764 1764 96.122 1451 2532 1 chr1B.!!$F3 1081
8 TraesCS2B01G611400 chr1B 22826556 22827617 1061 True 1616 1616 93.923 1451 2535 1 chr1B.!!$R1 1084
9 TraesCS2B01G611400 chr7B 150192987 150194060 1073 False 1748 1748 95.937 1450 2532 1 chr7B.!!$F1 1082
10 TraesCS2B01G611400 chr7B 426361103 426362178 1075 True 1740 1740 95.760 1451 2535 1 chr7B.!!$R1 1084
11 TraesCS2B01G611400 chr5B 129725560 129726639 1079 True 1746 1746 95.764 1450 2535 1 chr5B.!!$R3 1085
12 TraesCS2B01G611400 chr2D 644896580 644897608 1028 False 1498 1498 93.320 443 1450 1 chr2D.!!$F2 1007

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
509 527 7.393515 GTCCAATCAAAAATACCTGTCTACCTT 59.606 37.037 0.0 0.0 0.0 3.5 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2197 2297 1.384989 CGTGCAGGTCCCTCGTCTAT 61.385 60.0 0.0 0.0 0.0 1.98 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
509 527 7.393515 GTCCAATCAAAAATACCTGTCTACCTT 59.606 37.037 0.00 0.0 0.00 3.50
1428 1523 4.792068 ACTCTTTCAACTGATCCAACCAA 58.208 39.130 0.00 0.0 0.00 3.67
1847 1946 1.002684 CGAGAGCGTAGGATGGTGTAC 60.003 57.143 0.00 0.0 0.00 2.90
1904 2004 4.988716 TGTCGAGTCGGGGTGGCT 62.989 66.667 13.54 0.0 0.00 4.75
2168 2268 0.740868 CACGTCGTGGATGAAGGCAT 60.741 55.000 17.75 0.0 37.47 4.40
2241 2341 1.972198 TCGCCATGTCGGAGAAGTT 59.028 52.632 0.00 0.0 41.17 2.66
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1428 1523 2.863739 CGCGATCGGTACATATGTCAT 58.136 47.619 18.30 0.45 0.00 3.06
1847 1946 3.834799 GGCTACCTCGACCACGGG 61.835 72.222 0.00 0.00 40.02 5.28
1904 2004 2.649034 GCGACTTCCTCGACACCA 59.351 61.111 0.00 0.00 46.14 4.17
2122 2222 4.335647 CTGGCAAGCCTGGTCGGT 62.336 66.667 12.96 0.00 36.94 4.69
2168 2268 3.364441 GCTGGCAACACCGATGCA 61.364 61.111 0.00 0.00 46.17 3.96
2197 2297 1.384989 CGTGCAGGTCCCTCGTCTAT 61.385 60.000 0.00 0.00 0.00 1.98
2241 2341 3.870607 TTCTCTGCTGGCCCCTCCA 62.871 63.158 0.00 0.00 44.18 3.86


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.