Multiple sequence alignment - TraesCS2B01G611300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G611300 chr2B 100.000 2387 0 0 1 2387 790622741 790625127 0.000000e+00 4409.0
1 TraesCS2B01G611300 chr2B 86.301 1584 168 27 700 2270 790612616 790614163 0.000000e+00 1677.0
2 TraesCS2B01G611300 chr2D 97.148 2279 44 11 1 2272 644925345 644923081 0.000000e+00 3829.0
3 TraesCS2B01G611300 chr2D 87.178 1669 164 28 615 2270 644976041 644974410 0.000000e+00 1851.0
4 TraesCS2B01G611300 chr2D 92.979 1111 63 12 615 1718 644981534 644980432 0.000000e+00 1605.0
5 TraesCS2B01G611300 chr2D 81.330 782 128 9 765 1538 644733796 644733025 9.370000e-174 619.0
6 TraesCS2B01G611300 chr2D 75.226 775 141 32 814 1546 579511275 579510510 1.060000e-83 320.0
7 TraesCS2B01G611300 chr2D 95.763 118 2 1 2270 2387 644922654 644922540 1.130000e-43 187.0
8 TraesCS2B01G611300 chr2A 97.339 1804 38 6 592 2387 770291266 770289465 0.000000e+00 3057.0
9 TraesCS2B01G611300 chr2A 85.204 1203 125 28 1079 2270 770343037 770341877 0.000000e+00 1186.0
10 TraesCS2B01G611300 chr2A 95.017 602 19 6 1 596 770309880 770309284 0.000000e+00 935.0
11 TraesCS2B01G611300 chr2A 88.968 281 29 1 700 978 770343314 770343034 1.760000e-91 346.0
12 TraesCS2B01G611300 chr2A 90.123 81 7 1 615 695 770344977 770344898 1.170000e-18 104.0
13 TraesCS2B01G611300 chr3B 89.390 1442 134 16 612 2041 48668842 48667408 0.000000e+00 1797.0
14 TraesCS2B01G611300 chr4B 82.043 323 50 6 1 319 369839720 369839402 3.910000e-68 268.0
15 TraesCS2B01G611300 chr3A 81.505 319 56 3 1 318 460759615 460759931 2.350000e-65 259.0
16 TraesCS2B01G611300 chr3A 88.060 67 7 1 2267 2333 720856501 720856566 7.070000e-11 78.7
17 TraesCS2B01G611300 chr3A 87.500 64 7 1 2267 2330 549912962 549913024 3.290000e-09 73.1
18 TraesCS2B01G611300 chr7B 81.250 320 56 4 2 319 48953079 48952762 3.040000e-64 255.0
19 TraesCS2B01G611300 chr5B 80.374 321 57 6 1 318 270756565 270756248 3.070000e-59 239.0
20 TraesCS2B01G611300 chr5B 80.312 320 55 7 1 316 585259191 585259506 3.970000e-58 235.0
21 TraesCS2B01G611300 chr3D 80.844 308 55 4 1 306 532704861 532705166 3.070000e-59 239.0
22 TraesCS2B01G611300 chr1D 81.081 296 55 1 2 297 490551894 490552188 3.970000e-58 235.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G611300 chr2B 790622741 790625127 2386 False 4409.000000 4409 100.000000 1 2387 1 chr2B.!!$F2 2386
1 TraesCS2B01G611300 chr2B 790612616 790614163 1547 False 1677.000000 1677 86.301000 700 2270 1 chr2B.!!$F1 1570
2 TraesCS2B01G611300 chr2D 644922540 644925345 2805 True 2008.000000 3829 96.455500 1 2387 2 chr2D.!!$R5 2386
3 TraesCS2B01G611300 chr2D 644974410 644976041 1631 True 1851.000000 1851 87.178000 615 2270 1 chr2D.!!$R3 1655
4 TraesCS2B01G611300 chr2D 644980432 644981534 1102 True 1605.000000 1605 92.979000 615 1718 1 chr2D.!!$R4 1103
5 TraesCS2B01G611300 chr2D 644733025 644733796 771 True 619.000000 619 81.330000 765 1538 1 chr2D.!!$R2 773
6 TraesCS2B01G611300 chr2D 579510510 579511275 765 True 320.000000 320 75.226000 814 1546 1 chr2D.!!$R1 732
7 TraesCS2B01G611300 chr2A 770289465 770291266 1801 True 3057.000000 3057 97.339000 592 2387 1 chr2A.!!$R1 1795
8 TraesCS2B01G611300 chr2A 770309284 770309880 596 True 935.000000 935 95.017000 1 596 1 chr2A.!!$R2 595
9 TraesCS2B01G611300 chr2A 770341877 770344977 3100 True 545.333333 1186 88.098333 615 2270 3 chr2A.!!$R3 1655
10 TraesCS2B01G611300 chr3B 48667408 48668842 1434 True 1797.000000 1797 89.390000 612 2041 1 chr3B.!!$R1 1429

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
456 459 1.066471 AAATTTGCCAACCCTGCCAT 58.934 45.0 0.0 0.0 0.0 4.4 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1423 3039 4.862641 ACCCAGCTAACAAATCTGGTAT 57.137 40.909 6.74 0.0 44.41 2.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
81 84 9.468532 GATTTGCTCATTACAAGAAGAACTTTT 57.531 29.630 0.00 0.00 36.61 2.27
319 322 4.264442 CCCCTATACTAGTAGGCCATCACT 60.264 50.000 5.01 7.78 39.97 3.41
456 459 1.066471 AAATTTGCCAACCCTGCCAT 58.934 45.000 0.00 0.00 0.00 4.40
536 540 2.509548 TGGCCAGCCATTTCTGTACTAT 59.490 45.455 7.43 0.00 41.89 2.12
698 2282 4.262765 GGGTGCACTAGTTACTACCTTTGT 60.263 45.833 17.98 0.00 0.00 2.83
1050 2666 2.472695 TTGTTGCGTTCCTCTATGCT 57.527 45.000 0.00 0.00 0.00 3.79
1245 2861 1.675641 GGTGGTAAGTGGCAGGCAG 60.676 63.158 0.00 0.00 0.00 4.85
1639 3271 8.860088 ACAAAAATGAGGTTTTAGCACTAGATT 58.140 29.630 0.00 0.00 39.05 2.40
2212 3854 1.908619 TGAAGGAGAGCCACTTATGCA 59.091 47.619 0.00 0.00 36.29 3.96
2344 4415 8.418597 TTCTAGGAACTACTTTGTAGTGACAT 57.581 34.615 10.61 8.65 41.75 3.06
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
19 20 3.367646 TGGGAAGTCTCGTCTAGTCAT 57.632 47.619 0.00 0.0 0.00 3.06
179 182 9.275231 CAAGTGTCGTAAGTAGTAATAACAGAG 57.725 37.037 0.00 0.0 39.48 3.35
244 247 2.151202 GTCGAACCCAATGAGAAGCAA 58.849 47.619 0.00 0.0 0.00 3.91
319 322 0.837272 GGCCTGTTAGGACCATGCTA 59.163 55.000 0.00 0.0 37.46 3.49
519 523 9.722056 GAAAATACAATAGTACAGAAATGGCTG 57.278 33.333 0.00 0.0 41.63 4.85
802 2388 2.643801 TGACAACCTTTTATACGGGGGT 59.356 45.455 0.00 0.0 0.00 4.95
1245 2861 4.936891 AGTTCATTCCAGAAACAAGTTGC 58.063 39.130 1.81 0.0 0.00 4.17
1423 3039 4.862641 ACCCAGCTAACAAATCTGGTAT 57.137 40.909 6.74 0.0 44.41 2.73
1639 3271 4.956085 CACGGGTTATAGTGGAATGATCA 58.044 43.478 0.00 0.0 34.93 2.92
2212 3854 8.325787 TCTTTACACACCCATGTACTTATTGAT 58.674 33.333 0.00 0.0 36.72 2.57
2344 4415 7.127405 TCTATCCCTACAATAGTACACAACCA 58.873 38.462 0.00 0.0 0.00 3.67


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.