Multiple sequence alignment - TraesCS2B01G601700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G601700 chr2B 100.000 2285 0 0 1 2285 784319240 784321524 0.000000e+00 4220
1 TraesCS2B01G601700 chr2B 98.293 2285 36 1 1 2285 783919500 783917219 0.000000e+00 4000
2 TraesCS2B01G601700 chr2B 97.023 2284 52 6 8 2285 783933363 783931090 0.000000e+00 3827
3 TraesCS2B01G601700 chr2B 91.537 1028 74 8 705 1721 713704041 713703016 0.000000e+00 1404
4 TraesCS2B01G601700 chr2B 89.193 694 64 9 2 690 784524908 784525595 0.000000e+00 856
5 TraesCS2B01G601700 chr2B 90.811 370 33 1 1901 2270 784307516 784307884 5.670000e-136 494
6 TraesCS2B01G601700 chr2B 92.568 148 6 3 1726 1873 784307375 784307517 8.270000e-50 207
7 TraesCS2B01G601700 chr2B 91.935 124 9 1 1984 2107 520150024 520149902 3.020000e-39 172
8 TraesCS2B01G601700 chr4D 92.023 1028 70 5 711 1727 493970406 493969380 0.000000e+00 1434
9 TraesCS2B01G601700 chr4D 91.868 1033 72 5 705 1726 116523863 116522832 0.000000e+00 1432
10 TraesCS2B01G601700 chr4D 91.006 1034 79 6 705 1726 421047937 421046906 0.000000e+00 1382
11 TraesCS2B01G601700 chr3A 91.902 1025 72 4 705 1718 418764961 418763937 0.000000e+00 1423
12 TraesCS2B01G601700 chr3A 90.323 124 11 1 1984 2107 102834765 102834643 6.530000e-36 161
13 TraesCS2B01G601700 chr3D 90.874 1041 83 6 697 1726 515007302 515008341 0.000000e+00 1386
14 TraesCS2B01G601700 chr5A 91.139 1027 79 5 705 1720 604231363 604230338 0.000000e+00 1382
15 TraesCS2B01G601700 chr5A 85.437 103 14 1 30 132 653659042 653658941 3.100000e-19 106
16 TraesCS2B01G601700 chr2D 89.813 697 58 10 2 690 648458924 648459615 0.000000e+00 881
17 TraesCS2B01G601700 chr2D 82.137 627 83 14 34 636 578334607 578335228 5.630000e-141 510
18 TraesCS2B01G601700 chr2D 81.949 626 85 14 34 636 578368514 578369134 2.620000e-139 505
19 TraesCS2B01G601700 chr1A 82.983 523 72 16 128 636 534356267 534355748 7.440000e-125 457
20 TraesCS2B01G601700 chr1A 82.983 523 72 16 128 636 534391140 534390621 7.440000e-125 457
21 TraesCS2B01G601700 chr1A 91.935 124 9 1 1984 2107 415644529 415644651 3.020000e-39 172
22 TraesCS2B01G601700 chrUn 82.792 523 73 16 128 636 228955141 228955660 3.460000e-123 451
23 TraesCS2B01G601700 chr5B 92.742 124 8 1 1984 2107 664882366 664882244 6.490000e-41 178
24 TraesCS2B01G601700 chr6B 89.552 134 11 2 1981 2114 660245363 660245233 1.400000e-37 167
25 TraesCS2B01G601700 chr7A 88.406 138 15 1 1978 2114 709387057 709387194 5.050000e-37 165


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G601700 chr2B 784319240 784321524 2284 False 4220.0 4220 100.0000 1 2285 1 chr2B.!!$F1 2284
1 TraesCS2B01G601700 chr2B 783917219 783919500 2281 True 4000.0 4000 98.2930 1 2285 1 chr2B.!!$R3 2284
2 TraesCS2B01G601700 chr2B 783931090 783933363 2273 True 3827.0 3827 97.0230 8 2285 1 chr2B.!!$R4 2277
3 TraesCS2B01G601700 chr2B 713703016 713704041 1025 True 1404.0 1404 91.5370 705 1721 1 chr2B.!!$R2 1016
4 TraesCS2B01G601700 chr2B 784524908 784525595 687 False 856.0 856 89.1930 2 690 1 chr2B.!!$F2 688
5 TraesCS2B01G601700 chr2B 784307375 784307884 509 False 350.5 494 91.6895 1726 2270 2 chr2B.!!$F3 544
6 TraesCS2B01G601700 chr4D 493969380 493970406 1026 True 1434.0 1434 92.0230 711 1727 1 chr4D.!!$R3 1016
7 TraesCS2B01G601700 chr4D 116522832 116523863 1031 True 1432.0 1432 91.8680 705 1726 1 chr4D.!!$R1 1021
8 TraesCS2B01G601700 chr4D 421046906 421047937 1031 True 1382.0 1382 91.0060 705 1726 1 chr4D.!!$R2 1021
9 TraesCS2B01G601700 chr3A 418763937 418764961 1024 True 1423.0 1423 91.9020 705 1718 1 chr3A.!!$R2 1013
10 TraesCS2B01G601700 chr3D 515007302 515008341 1039 False 1386.0 1386 90.8740 697 1726 1 chr3D.!!$F1 1029
11 TraesCS2B01G601700 chr5A 604230338 604231363 1025 True 1382.0 1382 91.1390 705 1720 1 chr5A.!!$R1 1015
12 TraesCS2B01G601700 chr2D 648458924 648459615 691 False 881.0 881 89.8130 2 690 1 chr2D.!!$F3 688
13 TraesCS2B01G601700 chr2D 578334607 578335228 621 False 510.0 510 82.1370 34 636 1 chr2D.!!$F1 602
14 TraesCS2B01G601700 chr2D 578368514 578369134 620 False 505.0 505 81.9490 34 636 1 chr2D.!!$F2 602
15 TraesCS2B01G601700 chr1A 534355748 534356267 519 True 457.0 457 82.9830 128 636 1 chr1A.!!$R1 508
16 TraesCS2B01G601700 chr1A 534390621 534391140 519 True 457.0 457 82.9830 128 636 1 chr1A.!!$R2 508
17 TraesCS2B01G601700 chrUn 228955141 228955660 519 False 451.0 451 82.7920 128 636 1 chrUn.!!$F1 508

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
637 673 3.424703 CACTTGAAGAACACCCATCCAT 58.575 45.455 0.0 0.0 0.0 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2118 2181 0.250858 AGTGTGCATGTTGCTGGCTA 60.251 50.0 0.0 0.0 45.31 3.93 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
24 25 4.192317 AGGCAAACTCTAAGCTAATTCCG 58.808 43.478 0.00 0.00 0.00 4.30
203 224 8.510505 TCATTGAACGACATTTTGATACATTGA 58.489 29.630 0.00 0.00 0.00 2.57
204 225 8.791605 CATTGAACGACATTTTGATACATTGAG 58.208 33.333 0.00 0.00 0.00 3.02
293 316 8.567285 ACACCTTAAAAGATATCCAAGTTCTG 57.433 34.615 0.00 0.00 0.00 3.02
637 673 3.424703 CACTTGAAGAACACCCATCCAT 58.575 45.455 0.00 0.00 0.00 3.41
1137 1182 4.029809 GGTTGGGCCACCTACGCT 62.030 66.667 5.23 0.00 42.49 5.07
1180 1225 1.621317 TCTACATGGTGGCGTTCAAGA 59.379 47.619 0.00 0.00 0.00 3.02
1226 1271 2.612212 TCATCATCTTCGACGACGATGA 59.388 45.455 34.85 34.85 46.16 2.92
1228 1273 2.600084 ATCATCTTCGACGACGATGACG 60.600 50.000 35.25 17.51 45.38 4.35
1620 1677 1.217244 GAGGGCATGCAGGCAAAAG 59.783 57.895 26.25 0.00 46.44 2.27
1794 1856 3.043713 TCAAGCAACCGCAGCGAG 61.044 61.111 18.75 9.19 42.27 5.03
1887 1950 3.521529 AAAGTCGAGCCGTGCTGCT 62.522 57.895 0.00 0.00 46.37 4.24
1954 2017 1.204704 TGCATCTCCGTCTTTCGACAT 59.795 47.619 0.00 0.00 42.86 3.06
2118 2181 1.043673 CGGAAGGGCTAGTAGGCAGT 61.044 60.000 23.73 11.54 43.44 4.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
24 25 6.293698 TCCGCCTAATCCTCCTTTATTTTAC 58.706 40.000 0.00 0.00 0.00 2.01
203 224 8.164070 AGAAAAGAGTTGGTGAATTATGTACCT 58.836 33.333 0.00 0.00 35.51 3.08
204 225 8.336801 AGAAAAGAGTTGGTGAATTATGTACC 57.663 34.615 0.00 0.00 35.05 3.34
293 316 2.973945 CCAACTAGTGGGAGCACTTAC 58.026 52.381 11.30 0.00 44.64 2.34
1137 1182 3.461061 GATCTTGATCTGATGAACGGCA 58.539 45.455 0.00 0.00 0.00 5.69
1180 1225 0.415429 AGGGTGTCAGGAGTGAGGAT 59.585 55.000 0.00 0.00 31.53 3.24
1300 1354 5.058490 AGCAGACTCGATAGTACTTAGGAC 58.942 45.833 0.00 0.00 35.56 3.85
1887 1950 4.735132 GTGCTCGCAGGCGTGGTA 62.735 66.667 13.83 5.01 40.74 3.25
2118 2181 0.250858 AGTGTGCATGTTGCTGGCTA 60.251 50.000 0.00 0.00 45.31 3.93


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.