Multiple sequence alignment - TraesCS2B01G600700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G600700 chr2B 100.000 2285 0 0 1 2285 783919503 783917219 0.000000e+00 4220
1 TraesCS2B01G600700 chr2B 98.295 2288 36 1 1 2285 784319237 784321524 0.000000e+00 4006
2 TraesCS2B01G600700 chr2B 96.949 2294 51 6 1 2285 783933373 783931090 0.000000e+00 3831
3 TraesCS2B01G600700 chr2B 91.537 1028 74 8 705 1721 713704041 713703016 0.000000e+00 1404
4 TraesCS2B01G600700 chr2B 89.813 697 59 9 1 690 784524904 784525595 0.000000e+00 883
5 TraesCS2B01G600700 chr2B 90.811 370 33 1 1901 2270 784307516 784307884 5.670000e-136 494
6 TraesCS2B01G600700 chr2B 92.568 148 6 3 1726 1873 784307375 784307517 8.270000e-50 207
7 TraesCS2B01G600700 chr2B 89.600 125 10 3 1984 2107 520150024 520149902 3.040000e-34 156
8 TraesCS2B01G600700 chr4D 92.121 1028 69 5 711 1727 493970406 493969380 0.000000e+00 1439
9 TraesCS2B01G600700 chr4D 91.965 1033 71 5 705 1726 116523863 116522832 0.000000e+00 1437
10 TraesCS2B01G600700 chr3A 91.902 1025 72 4 705 1718 418764961 418763937 0.000000e+00 1423
11 TraesCS2B01G600700 chr4A 91.279 1032 77 7 705 1725 327747675 327746646 0.000000e+00 1395
12 TraesCS2B01G600700 chr3D 90.874 1041 83 5 697 1726 515007302 515008341 0.000000e+00 1386
13 TraesCS2B01G600700 chr5A 91.139 1027 79 5 705 1720 604231363 604230338 0.000000e+00 1382
14 TraesCS2B01G600700 chr5A 85.437 103 14 1 33 135 653659042 653658941 3.100000e-19 106
15 TraesCS2B01G600700 chr2D 90.000 700 56 8 1 690 648458920 648459615 0.000000e+00 893
16 TraesCS2B01G600700 chr2D 82.567 631 80 14 37 643 578334607 578335231 1.550000e-146 529
17 TraesCS2B01G600700 chr2D 82.381 630 82 14 37 643 578368514 578369137 2.600000e-144 521
18 TraesCS2B01G600700 chr5D 84.069 521 66 12 138 643 291357776 291357258 9.490000e-134 486
19 TraesCS2B01G600700 chr1A 83.365 523 70 16 131 639 534356267 534355748 3.440000e-128 468
20 TraesCS2B01G600700 chrUn 83.144 528 71 17 131 644 228955141 228955664 1.240000e-127 466
21 TraesCS2B01G600700 chr7B 88.976 127 13 1 1981 2107 118126204 118126329 3.040000e-34 156
22 TraesCS2B01G600700 chr6B 88.060 134 13 2 1981 2114 660245363 660245233 3.040000e-34 156
23 TraesCS2B01G600700 chr5B 89.516 124 12 1 1984 2107 664882366 664882244 3.040000e-34 156
24 TraesCS2B01G600700 chr7A 86.957 138 17 1 1978 2114 709387057 709387194 1.090000e-33 154
25 TraesCS2B01G600700 chr4B 88.372 129 11 4 1980 2107 629776088 629775963 3.930000e-33 152


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G600700 chr2B 783917219 783919503 2284 True 4220.0 4220 100.0000 1 2285 1 chr2B.!!$R3 2284
1 TraesCS2B01G600700 chr2B 784319237 784321524 2287 False 4006.0 4006 98.2950 1 2285 1 chr2B.!!$F1 2284
2 TraesCS2B01G600700 chr2B 783931090 783933373 2283 True 3831.0 3831 96.9490 1 2285 1 chr2B.!!$R4 2284
3 TraesCS2B01G600700 chr2B 713703016 713704041 1025 True 1404.0 1404 91.5370 705 1721 1 chr2B.!!$R2 1016
4 TraesCS2B01G600700 chr2B 784524904 784525595 691 False 883.0 883 89.8130 1 690 1 chr2B.!!$F2 689
5 TraesCS2B01G600700 chr2B 784307375 784307884 509 False 350.5 494 91.6895 1726 2270 2 chr2B.!!$F3 544
6 TraesCS2B01G600700 chr4D 493969380 493970406 1026 True 1439.0 1439 92.1210 711 1727 1 chr4D.!!$R2 1016
7 TraesCS2B01G600700 chr4D 116522832 116523863 1031 True 1437.0 1437 91.9650 705 1726 1 chr4D.!!$R1 1021
8 TraesCS2B01G600700 chr3A 418763937 418764961 1024 True 1423.0 1423 91.9020 705 1718 1 chr3A.!!$R1 1013
9 TraesCS2B01G600700 chr4A 327746646 327747675 1029 True 1395.0 1395 91.2790 705 1725 1 chr4A.!!$R1 1020
10 TraesCS2B01G600700 chr3D 515007302 515008341 1039 False 1386.0 1386 90.8740 697 1726 1 chr3D.!!$F1 1029
11 TraesCS2B01G600700 chr5A 604230338 604231363 1025 True 1382.0 1382 91.1390 705 1720 1 chr5A.!!$R1 1015
12 TraesCS2B01G600700 chr2D 648458920 648459615 695 False 893.0 893 90.0000 1 690 1 chr2D.!!$F3 689
13 TraesCS2B01G600700 chr2D 578334607 578335231 624 False 529.0 529 82.5670 37 643 1 chr2D.!!$F1 606
14 TraesCS2B01G600700 chr2D 578368514 578369137 623 False 521.0 521 82.3810 37 643 1 chr2D.!!$F2 606
15 TraesCS2B01G600700 chr5D 291357258 291357776 518 True 486.0 486 84.0690 138 643 1 chr5D.!!$R1 505
16 TraesCS2B01G600700 chr1A 534355748 534356267 519 True 468.0 468 83.3650 131 639 1 chr1A.!!$R1 508
17 TraesCS2B01G600700 chrUn 228955141 228955664 523 False 466.0 466 83.1440 131 644 1 chrUn.!!$F1 513

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
81 85 2.265589 AGTGGAGTGTTTTTACCCCG 57.734 50.0 0.00 0.00 0.00 5.73 F
1228 1297 2.600084 ATCATCTTCGACGACGATGACG 60.600 50.0 35.25 17.51 45.38 4.35 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1230 1299 0.813610 CGCACTTGTTGACCACCTCA 60.814 55.0 0.00 0.00 0.00 3.86 R
2127 2205 2.159099 TGCCTACTAGTAGTGTGCATGC 60.159 50.0 24.84 19.26 33.25 4.06 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
81 85 2.265589 AGTGGAGTGTTTTTACCCCG 57.734 50.000 0.00 0.00 0.00 5.73
1226 1295 2.612212 TCATCATCTTCGACGACGATGA 59.388 45.455 34.85 34.85 46.16 2.92
1227 1296 2.716504 CATCATCTTCGACGACGATGAC 59.283 50.000 35.25 0.00 45.38 3.06
1228 1297 2.600084 ATCATCTTCGACGACGATGACG 60.600 50.000 35.25 17.51 45.38 4.35
1329 1398 9.731819 CTAAGTACTATCGAGTTTGCTTTATGA 57.268 33.333 0.00 0.00 37.10 2.15
1615 1684 2.044650 GCAAGAGGGCATGCAGGA 60.045 61.111 21.36 0.00 42.12 3.86
2107 2185 6.943718 TGATAAGTATTTTCAAACGGAAGGGT 59.056 34.615 0.00 0.00 33.14 4.34
2281 2359 1.542915 GGTTTGCTGACACATGCATCT 59.457 47.619 0.00 0.00 39.07 2.90
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
81 85 1.162698 GGTCGGGCCAAAAGTTAGTC 58.837 55.000 4.39 0.00 37.17 2.59
880 928 2.185350 CTCCTCCATGCGCTCGTT 59.815 61.111 9.73 0.00 0.00 3.85
1105 1156 1.842562 CCAACCCTGATCCAGAGTCAT 59.157 52.381 0.00 0.00 32.44 3.06
1229 1298 1.388547 GCACTTGTTGACCACCTCAA 58.611 50.000 0.00 0.00 36.46 3.02
1230 1299 0.813610 CGCACTTGTTGACCACCTCA 60.814 55.000 0.00 0.00 0.00 3.86
1231 1300 1.507141 CCGCACTTGTTGACCACCTC 61.507 60.000 0.00 0.00 0.00 3.85
1232 1301 1.525995 CCGCACTTGTTGACCACCT 60.526 57.895 0.00 0.00 0.00 4.00
1615 1684 5.590530 TGCACCATCTACAAGTTGTTTTT 57.409 34.783 14.90 0.00 0.00 1.94
2127 2205 2.159099 TGCCTACTAGTAGTGTGCATGC 60.159 50.000 24.84 19.26 33.25 4.06


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.