Multiple sequence alignment - TraesCS2B01G600100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G600100 chr2B 100.000 3039 0 0 1 3039 782962369 782959331 0.000000e+00 5613.0
1 TraesCS2B01G600100 chr2B 99.441 3041 11 3 1 3039 782837243 782834207 0.000000e+00 5517.0
2 TraesCS2B01G600100 chr2B 100.000 1924 0 0 3153 5076 782959217 782957294 0.000000e+00 3554.0
3 TraesCS2B01G600100 chr2B 99.325 1925 8 2 3153 5076 782834180 782832260 0.000000e+00 3478.0
4 TraesCS2B01G600100 chr2B 97.257 1422 29 5 251 1671 783230835 783229423 0.000000e+00 2401.0
5 TraesCS2B01G600100 chr2B 95.468 1324 51 5 251 1568 782537756 782536436 0.000000e+00 2104.0
6 TraesCS2B01G600100 chr2B 94.789 1324 58 5 251 1568 782688215 782686897 0.000000e+00 2052.0
7 TraesCS2B01G600100 chr2B 95.731 1265 36 6 1793 3039 783229426 783228162 0.000000e+00 2021.0
8 TraesCS2B01G600100 chr2B 94.422 1255 62 4 1793 3039 782536288 782535034 0.000000e+00 1923.0
9 TraesCS2B01G600100 chr2B 93.631 1256 71 5 1793 3039 782686749 782685494 0.000000e+00 1868.0
10 TraesCS2B01G600100 chr2B 87.563 1391 57 33 3354 4687 783227986 783226655 0.000000e+00 1504.0
11 TraesCS2B01G600100 chr2B 91.511 695 37 11 3830 4510 782534502 782533816 0.000000e+00 937.0
12 TraesCS2B01G600100 chr2B 91.511 695 37 9 3830 4510 782684963 782684277 0.000000e+00 937.0
13 TraesCS2B01G600100 chr2B 86.676 743 65 18 3776 4511 782531189 782530474 0.000000e+00 793.0
14 TraesCS2B01G600100 chr2B 86.119 742 70 17 3776 4511 782681641 782680927 0.000000e+00 769.0
15 TraesCS2B01G600100 chr2B 89.302 430 38 6 3354 3776 782685388 782684960 2.690000e-147 532.0
16 TraesCS2B01G600100 chr2B 88.631 431 40 7 3354 3776 782534928 782534499 2.710000e-142 516.0
17 TraesCS2B01G600100 chr2B 92.857 252 13 3 4829 5076 782524913 782524663 1.340000e-95 361.0
18 TraesCS2B01G600100 chr2B 92.490 253 13 4 4829 5076 782680500 782680249 1.740000e-94 357.0
19 TraesCS2B01G600100 chr2B 95.876 194 3 3 3153 3346 783228131 783227943 4.940000e-80 309.0
20 TraesCS2B01G600100 chr2B 92.442 172 9 2 4829 4996 782533648 782533477 5.080000e-60 243.0
21 TraesCS2B01G600100 chr2B 90.698 172 12 2 4829 4996 782684109 782683938 5.110000e-55 226.0
22 TraesCS2B01G600100 chr2B 94.891 137 7 0 1663 1799 550044048 550044184 1.110000e-51 215.0
23 TraesCS2B01G600100 chr2B 94.074 135 6 2 4943 5076 782513579 782513446 2.400000e-48 204.0
24 TraesCS2B01G600100 chr2B 86.471 170 22 1 3566 3734 782682104 782681935 8.680000e-43 185.0
25 TraesCS2B01G600100 chr2B 97.222 108 3 0 1564 1671 782536392 782536285 3.120000e-42 183.0
26 TraesCS2B01G600100 chr2B 85.882 170 23 1 3566 3734 782531652 782531483 4.040000e-41 180.0
27 TraesCS2B01G600100 chr2B 95.370 108 5 0 1564 1671 782686853 782686746 6.760000e-39 172.0
28 TraesCS2B01G600100 chr2B 90.840 131 6 4 4700 4829 782684272 782684147 2.430000e-38 171.0
29 TraesCS2B01G600100 chr2B 90.076 131 7 4 4700 4829 782533811 782533686 1.130000e-36 165.0
30 TraesCS2B01G600100 chr2B 89.683 126 9 2 4402 4527 782680920 782680799 1.890000e-34 158.0
31 TraesCS2B01G600100 chr2B 91.228 114 7 3 4717 4829 783226653 783226542 8.800000e-33 152.0
32 TraesCS2B01G600100 chr2B 91.667 84 7 0 4993 5076 782683857 782683774 3.210000e-22 117.0
33 TraesCS2B01G600100 chr2B 90.476 84 8 0 4993 5076 782533406 782533323 1.490000e-20 111.0
34 TraesCS2B01G600100 chr2B 93.056 72 5 0 3153 3224 782535027 782534956 6.950000e-19 106.0
35 TraesCS2B01G600100 chr2B 93.056 72 5 0 3153 3224 782685487 782685416 6.950000e-19 106.0
36 TraesCS2B01G600100 chr2B 98.276 58 1 0 3279 3336 782534950 782534893 8.990000e-18 102.0
37 TraesCS2B01G600100 chr2B 98.276 58 1 0 3279 3336 782685410 782685353 8.990000e-18 102.0
38 TraesCS2B01G600100 chr2B 85.938 64 5 4 4531 4591 28017470 28017408 1.180000e-06 65.8
39 TraesCS2B01G600100 chr2D 94.444 1260 56 6 1793 3039 648240832 648239574 0.000000e+00 1927.0
40 TraesCS2B01G600100 chr2D 89.364 818 44 18 3354 4129 648239400 648238584 0.000000e+00 989.0
41 TraesCS2B01G600100 chr2D 87.910 670 55 13 831 1496 648241570 648240923 0.000000e+00 765.0
42 TraesCS2B01G600100 chr2D 94.710 397 19 2 251 647 648242576 648242182 2.600000e-172 616.0
43 TraesCS2B01G600100 chr2D 87.321 489 43 9 4352 4829 648238584 648238104 4.470000e-150 542.0
44 TraesCS2B01G600100 chr2D 93.600 125 6 1 674 796 648242082 648241958 8.680000e-43 185.0
45 TraesCS2B01G600100 chr2D 81.773 203 18 7 3153 3336 648239567 648239365 8.800000e-33 152.0
46 TraesCS2B01G600100 chr2D 92.453 53 1 3 4531 4583 598272410 598272361 7.050000e-09 73.1
47 TraesCS2B01G600100 chrUn 93.040 1250 81 5 1795 3039 31206803 31208051 0.000000e+00 1821.0
48 TraesCS2B01G600100 chrUn 91.340 739 54 4 828 1565 31205899 31206628 0.000000e+00 1002.0
49 TraesCS2B01G600100 chrUn 100.000 438 0 0 2572 3009 476027389 476027826 0.000000e+00 809.0
50 TraesCS2B01G600100 chrUn 93.913 230 9 2 251 476 31204807 31205035 4.870000e-90 342.0
51 TraesCS2B01G600100 chrUn 95.858 169 7 0 479 647 31205158 31205326 1.800000e-69 274.0
52 TraesCS2B01G600100 chrUn 83.410 217 24 8 3480 3696 31208318 31208522 1.870000e-44 191.0
53 TraesCS2B01G600100 chrUn 82.178 202 17 7 3154 3336 31208059 31208260 6.800000e-34 156.0
54 TraesCS2B01G600100 chrUn 92.453 53 1 2 4531 4583 112238495 112238446 7.050000e-09 73.1
55 TraesCS2B01G600100 chrUn 90.741 54 4 1 4531 4583 42172213 42172266 2.540000e-08 71.3
56 TraesCS2B01G600100 chr5B 85.958 1232 127 28 1821 3038 593211126 593209927 0.000000e+00 1275.0
57 TraesCS2B01G600100 chr5B 83.762 739 107 6 831 1568 593211991 593211265 0.000000e+00 688.0
58 TraesCS2B01G600100 chr5B 84.772 637 53 21 3897 4523 593233151 593232549 2.620000e-167 599.0
59 TraesCS2B01G600100 chr5B 79.167 408 62 11 3777 4183 593209183 593208798 1.400000e-65 261.0
60 TraesCS2B01G600100 chr5B 82.951 305 35 9 3404 3704 593209746 593209455 5.040000e-65 259.0
61 TraesCS2B01G600100 chr5B 80.159 378 46 17 288 645 593212973 593212605 6.520000e-64 255.0
62 TraesCS2B01G600100 chr5B 84.772 197 28 2 4590 4786 593232528 593232334 4.010000e-46 196.0
63 TraesCS2B01G600100 chr4A 92.405 237 10 5 18 252 448537556 448537786 1.050000e-86 331.0
64 TraesCS2B01G600100 chr3D 96.500 200 3 1 52 251 105444694 105444499 1.360000e-85 327.0
65 TraesCS2B01G600100 chr3D 93.427 213 10 3 39 250 179936868 179937077 3.820000e-81 313.0
66 TraesCS2B01G600100 chr7D 94.737 209 5 3 43 250 378164059 378163856 2.280000e-83 320.0
67 TraesCS2B01G600100 chr3A 95.545 202 5 1 49 250 204873874 204874071 2.280000e-83 320.0
68 TraesCS2B01G600100 chr6A 94.686 207 5 3 44 250 88084796 88084596 2.950000e-82 316.0
69 TraesCS2B01G600100 chr6A 90.244 246 14 6 18 261 426624463 426624226 3.820000e-81 313.0
70 TraesCS2B01G600100 chr5D 90.417 240 11 7 19 257 527195512 527195740 6.380000e-79 305.0
71 TraesCS2B01G600100 chr7B 94.286 140 6 2 1657 1796 741490869 741491006 3.980000e-51 213.0
72 TraesCS2B01G600100 chr7B 90.566 53 4 1 4531 4583 677782472 677782523 9.120000e-08 69.4
73 TraesCS2B01G600100 chr4B 93.706 143 7 2 1668 1808 576982568 576982426 3.980000e-51 213.0
74 TraesCS2B01G600100 chr1B 93.706 143 6 3 1663 1805 579776410 579776549 1.430000e-50 211.0
75 TraesCS2B01G600100 chr1B 89.873 158 12 4 1649 1805 623950939 623951093 3.100000e-47 200.0
76 TraesCS2B01G600100 chr1B 88.415 164 15 3 1635 1796 409879776 409879937 1.440000e-45 195.0
77 TraesCS2B01G600100 chr2A 93.571 140 7 2 1658 1797 6497010 6497147 1.850000e-49 207.0
78 TraesCS2B01G600100 chr2A 93.571 140 8 1 1655 1794 675020950 675021088 1.850000e-49 207.0
79 TraesCS2B01G600100 chr1D 92.453 53 3 1 4527 4579 140526967 140526916 1.960000e-09 75.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G600100 chr2B 782957294 782962369 5075 True 4583.500000 5613 100.000000 1 5076 2 chr2B.!!$R7 5075
1 TraesCS2B01G600100 chr2B 782832260 782837243 4983 True 4497.500000 5517 99.383000 1 5076 2 chr2B.!!$R6 5075
2 TraesCS2B01G600100 chr2B 783226542 783230835 4293 True 1277.400000 2401 93.531000 251 4829 5 chr2B.!!$R8 4578
3 TraesCS2B01G600100 chr2B 782530474 782537756 7282 True 613.583333 2104 92.011500 251 5076 12 chr2B.!!$R4 4825
4 TraesCS2B01G600100 chr2B 782680249 782688215 7966 True 553.714286 2052 91.707357 251 5076 14 chr2B.!!$R5 4825
5 TraesCS2B01G600100 chr2D 648238104 648242576 4472 True 739.428571 1927 89.874571 251 4829 7 chr2D.!!$R2 4578
6 TraesCS2B01G600100 chrUn 31204807 31208522 3715 False 631.000000 1821 89.956500 251 3696 6 chrUn.!!$F3 3445
7 TraesCS2B01G600100 chr5B 593208798 593212973 4175 True 547.600000 1275 82.399400 288 4183 5 chr5B.!!$R1 3895
8 TraesCS2B01G600100 chr5B 593232334 593233151 817 True 397.500000 599 84.772000 3897 4786 2 chr5B.!!$R2 889

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
225 226 5.243060 GGGATAAATACAAAGGGGTACATGC 59.757 44.000 0.00 0.00 0.00 4.06 F
228 229 5.596836 AAATACAAAGGGGTACATGCATG 57.403 39.130 25.09 25.09 0.00 4.06 F
476 485 5.851177 GGTGTCAACTGTTTCAATGATAACG 59.149 40.000 0.00 0.00 0.00 3.18 F
1713 2413 8.096414 ACTTGTCATCAAAATGGATAAAAAGGG 58.904 33.333 0.00 0.00 33.42 3.95 F
3402 4160 5.891451 TCTGACGTCATTACACTAATCCTG 58.109 41.667 20.40 1.84 0.00 3.86 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1851 2553 5.898606 GCGAATTGTTTGTAATCATCTCTCG 59.101 40.000 0.0 0.0 0.00 4.04 R
1852 2554 6.195165 GGCGAATTGTTTGTAATCATCTCTC 58.805 40.000 0.0 0.0 0.00 3.20 R
3246 3999 1.073923 ACCTAAGCAACCCCTTGACAG 59.926 52.381 0.0 0.0 0.00 3.51 R
3402 4160 7.369803 ACATTAGTGTGTGTCAATCTTCATC 57.630 36.000 0.0 0.0 37.14 2.92 R
4966 9437 1.331214 ACAACACCATGAGCCAAAGG 58.669 50.000 0.0 0.0 0.00 3.11 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
225 226 5.243060 GGGATAAATACAAAGGGGTACATGC 59.757 44.000 0.00 0.00 0.00 4.06
226 227 5.830991 GGATAAATACAAAGGGGTACATGCA 59.169 40.000 0.00 0.00 0.00 3.96
227 228 6.493458 GGATAAATACAAAGGGGTACATGCAT 59.507 38.462 0.00 0.00 0.00 3.96
228 229 5.596836 AAATACAAAGGGGTACATGCATG 57.403 39.130 25.09 25.09 0.00 4.06
476 485 5.851177 GGTGTCAACTGTTTCAATGATAACG 59.149 40.000 0.00 0.00 0.00 3.18
1713 2413 8.096414 ACTTGTCATCAAAATGGATAAAAAGGG 58.904 33.333 0.00 0.00 33.42 3.95
3402 4160 5.891451 TCTGACGTCATTACACTAATCCTG 58.109 41.667 20.40 1.84 0.00 3.86
4384 5384 2.209838 ATGTCGAGATTACCTGTGCG 57.790 50.000 0.00 0.00 0.00 5.34
4966 9437 3.778954 AGGACATTTAGAGCTATGCCC 57.221 47.619 0.00 0.00 0.00 5.36
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
476 485 7.556275 TGACATCATGTTTTCCCTTAGGTATTC 59.444 37.037 0.0 0.0 0.00 1.75
1851 2553 5.898606 GCGAATTGTTTGTAATCATCTCTCG 59.101 40.000 0.0 0.0 0.00 4.04
1852 2554 6.195165 GGCGAATTGTTTGTAATCATCTCTC 58.805 40.000 0.0 0.0 0.00 3.20
3246 3999 1.073923 ACCTAAGCAACCCCTTGACAG 59.926 52.381 0.0 0.0 0.00 3.51
3402 4160 7.369803 ACATTAGTGTGTGTCAATCTTCATC 57.630 36.000 0.0 0.0 37.14 2.92
4348 5347 8.299262 TCTCGACATAAAGAGAAAGAAAACAG 57.701 34.615 0.0 0.0 40.18 3.16
4966 9437 1.331214 ACAACACCATGAGCCAAAGG 58.669 50.000 0.0 0.0 0.00 3.11


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.