Multiple sequence alignment - TraesCS2B01G595800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G595800 chr2B 100.000 3594 0 0 1 3594 779393529 779389936 0 6637
1 TraesCS2B01G595800 chr2B 99.110 3595 29 2 1 3594 779419229 779415637 0 6458
2 TraesCS2B01G595800 chr2B 99.054 3595 31 2 1 3594 779432138 779428546 0 6447
3 TraesCS2B01G595800 chr2B 99.026 3595 34 1 1 3594 779425683 779422089 0 6444
4 TraesCS2B01G595800 chr2B 98.999 3595 33 2 1 3594 779412780 779409188 0 6436
5 TraesCS2B01G595800 chr2B 98.331 3595 56 4 1 3594 779451427 779447836 0 6303
6 TraesCS2B01G595800 chr2B 98.275 3594 55 1 1 3594 779438585 779434999 0 6287
7 TraesCS2B01G595800 chrUn 99.249 3594 26 1 1 3594 280844240 280847832 0 6486


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G595800 chr2B 779389936 779393529 3593 True 6637.0 6637 100.0000 1 3594 1 chr2B.!!$R1 3593
1 TraesCS2B01G595800 chr2B 779409188 779438585 29397 True 6414.4 6458 98.8928 1 3594 5 chr2B.!!$R3 3593
2 TraesCS2B01G595800 chr2B 779447836 779451427 3591 True 6303.0 6303 98.3310 1 3594 1 chr2B.!!$R2 3593
3 TraesCS2B01G595800 chrUn 280844240 280847832 3592 False 6486.0 6486 99.2490 1 3594 1 chrUn.!!$F1 3593

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1201 20558 2.192263 TGCCACACATGTCATACCCTA 58.808 47.619 0.0 0.0 0.0 3.53 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2943 22300 6.528537 TGCATTTATTTTAGGCTGATGTGT 57.471 33.333 0.0 0.0 0.0 3.72 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1201 20558 2.192263 TGCCACACATGTCATACCCTA 58.808 47.619 0.00 0.00 0.00 3.53
1992 21349 6.544197 TGGCAGCGTATTTAATATTTGGAGAA 59.456 34.615 0.00 0.00 0.00 2.87
2409 21766 8.904834 TGCTAACAAGGTCTATGTGTTTTTAAA 58.095 29.630 0.00 0.00 36.83 1.52
2674 22031 8.682936 AGAAATATATCCATTGTGTCACCTTC 57.317 34.615 0.00 0.00 0.00 3.46
2789 22146 6.585322 GCTTTGTACTATTATTACGCGGAGAT 59.415 38.462 12.47 3.51 0.00 2.75
2943 22300 8.308931 CAACATACAACTGTAGGAGGTAGTAAA 58.691 37.037 8.41 0.00 36.00 2.01
3038 22395 7.950684 TCTTAGTATGGCACTAGTTATCATCCT 59.049 37.037 0.00 0.00 40.83 3.24
3137 22494 9.787435 AACTAAAACTTAGAACACCATATGACA 57.213 29.630 3.65 0.00 0.00 3.58
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
806 808 7.924358 TTTATTGAGGCCTAATCCTAGTGTA 57.076 36.000 4.42 0.0 36.38 2.90
1201 20558 6.186420 TGGTATGTATGTTGGTGCATCTAT 57.814 37.500 0.00 0.0 0.00 1.98
1992 21349 0.037160 TGATGCCATGCTGTGACAGT 59.963 50.000 14.82 0.0 33.43 3.55
2943 22300 6.528537 TGCATTTATTTTAGGCTGATGTGT 57.471 33.333 0.00 0.0 0.00 3.72
2996 22353 7.438459 CCATACTAAGACTAAATAGCACCACAC 59.562 40.741 0.00 0.0 0.00 3.82
3052 22409 8.671987 ATGATTTATAGTATGTCAGCTACCCT 57.328 34.615 0.00 0.0 0.00 4.34


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.