Multiple sequence alignment - TraesCS2B01G585500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G585500 chr2B 100.000 2663 0 0 1 2663 772252236 772249574 0 4918
1 TraesCS2B01G585500 chr2B 98.275 2667 40 6 1 2663 608457621 608460285 0 4665
2 TraesCS2B01G585500 chr2B 97.714 2669 52 9 1 2663 99567819 99565154 0 4582
3 TraesCS2B01G585500 chr2B 97.566 2670 54 11 1 2663 741912323 741909658 0 4560
4 TraesCS2B01G585500 chr2B 90.972 2315 160 26 1 2293 95261123 95258836 0 3072
5 TraesCS2B01G585500 chr2B 89.692 1882 143 30 795 2663 626148294 626146451 0 2353
6 TraesCS2B01G585500 chr6A 98.013 2668 44 8 1 2663 87943548 87940885 0 4625
7 TraesCS2B01G585500 chr2A 97.978 2670 45 9 1 2663 389206951 389209618 0 4623
8 TraesCS2B01G585500 chr7B 97.939 2668 48 7 1 2663 194130144 194127479 0 4615
9 TraesCS2B01G585500 chr7B 97.939 2668 48 7 1 2663 666524115 666526780 0 4615
10 TraesCS2B01G585500 chr5A 97.900 2667 49 6 1 2663 294236756 294234093 0 4608


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G585500 chr2B 772249574 772252236 2662 True 4918 4918 100.000 1 2663 1 chr2B.!!$R5 2662
1 TraesCS2B01G585500 chr2B 608457621 608460285 2664 False 4665 4665 98.275 1 2663 1 chr2B.!!$F1 2662
2 TraesCS2B01G585500 chr2B 99565154 99567819 2665 True 4582 4582 97.714 1 2663 1 chr2B.!!$R2 2662
3 TraesCS2B01G585500 chr2B 741909658 741912323 2665 True 4560 4560 97.566 1 2663 1 chr2B.!!$R4 2662
4 TraesCS2B01G585500 chr2B 95258836 95261123 2287 True 3072 3072 90.972 1 2293 1 chr2B.!!$R1 2292
5 TraesCS2B01G585500 chr2B 626146451 626148294 1843 True 2353 2353 89.692 795 2663 1 chr2B.!!$R3 1868
6 TraesCS2B01G585500 chr6A 87940885 87943548 2663 True 4625 4625 98.013 1 2663 1 chr6A.!!$R1 2662
7 TraesCS2B01G585500 chr2A 389206951 389209618 2667 False 4623 4623 97.978 1 2663 1 chr2A.!!$F1 2662
8 TraesCS2B01G585500 chr7B 194127479 194130144 2665 True 4615 4615 97.939 1 2663 1 chr7B.!!$R1 2662
9 TraesCS2B01G585500 chr7B 666524115 666526780 2665 False 4615 4615 97.939 1 2663 1 chr7B.!!$F1 2662
10 TraesCS2B01G585500 chr5A 294234093 294236756 2663 True 4608 4608 97.900 1 2663 1 chr5A.!!$R1 2662

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
648 651 2.038426 ACATACTGCCTAGTTGCACACA 59.962 45.455 0.0 0.0 38.36 3.72 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2128 2165 0.546598 GTAGCCCACTGCCCAACTAT 59.453 55.0 0.0 0.0 42.71 2.12 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
648 651 2.038426 ACATACTGCCTAGTTGCACACA 59.962 45.455 0.00 0.0 38.36 3.72
649 652 3.273434 CATACTGCCTAGTTGCACACAT 58.727 45.455 0.00 0.0 38.36 3.21
1260 1272 9.719355 AAAACCTAACTTGTTTTTCATGTTCTT 57.281 25.926 0.00 0.0 41.75 2.52
2128 2165 2.370849 GTTGAGTACTTCCTTGGGGTCA 59.629 50.000 0.00 0.0 0.00 4.02
2141 2178 0.394352 GGGGTCATAGTTGGGCAGTG 60.394 60.000 0.00 0.0 0.00 3.66
2295 2335 1.949525 CCTACTGTGCAACTGCTTGTT 59.050 47.619 2.95 0.0 39.67 2.83
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
8 9 1.621301 CGGTCTGAGCTCAAACGCAG 61.621 60.000 18.85 6.23 38.65 5.18
11 12 0.784778 GTTCGGTCTGAGCTCAAACG 59.215 55.000 22.33 22.33 0.00 3.60
224 225 1.594833 CCTGGCGCACTAGGTACAA 59.405 57.895 10.83 0.00 0.00 2.41
648 651 6.882610 TCTTGATGCTTGAACTAACACAAT 57.117 33.333 0.00 0.00 0.00 2.71
649 652 6.882610 ATCTTGATGCTTGAACTAACACAA 57.117 33.333 0.00 0.00 0.00 3.33
1238 1250 6.923508 GGGAAGAACATGAAAAACAAGTTAGG 59.076 38.462 0.00 0.00 39.90 2.69
1260 1272 1.968493 GGATTGTAGTCGCCTATGGGA 59.032 52.381 0.00 0.00 33.58 4.37
1818 1835 4.125703 CCAACAAAGGCACAAATAGCAAA 58.874 39.130 0.00 0.00 0.00 3.68
1934 1966 5.707298 AGATTTTGTAGTTGCACACTGCTAT 59.293 36.000 14.49 8.17 45.31 2.97
1977 2009 2.305927 TCCATGGAGGAAGTTTCTGGTC 59.694 50.000 11.44 0.00 45.65 4.02
2128 2165 0.546598 GTAGCCCACTGCCCAACTAT 59.453 55.000 0.00 0.00 42.71 2.12
2141 2178 1.146263 CCGAGTGGAATGGTAGCCC 59.854 63.158 0.00 0.00 37.49 5.19
2295 2335 5.123820 GGCACATAATGAGTTGCAGTAGAAA 59.876 40.000 0.00 0.00 29.64 2.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.