Multiple sequence alignment - TraesCS2B01G582000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G582000 chr2B 100.000 2687 0 0 1 2687 769429995 769427309 0.000000e+00 4963.0
1 TraesCS2B01G582000 chr2B 98.697 2687 32 1 1 2687 769379686 769377003 0.000000e+00 4765.0
2 TraesCS2B01G582000 chr2B 95.760 1863 24 8 1 1840 769308521 769306691 0.000000e+00 2952.0
3 TraesCS2B01G582000 chr2B 95.760 1863 23 9 1 1840 769336991 769335162 0.000000e+00 2952.0
4 TraesCS2B01G582000 chr2B 98.420 1582 22 1 1106 2687 769478557 769476979 0.000000e+00 2780.0
5 TraesCS2B01G582000 chr2B 87.146 1307 109 33 546 1821 769491838 769490560 0.000000e+00 1428.0
6 TraesCS2B01G582000 chr2B 91.005 756 62 6 24 778 769482343 769481593 0.000000e+00 1014.0
7 TraesCS2B01G582000 chr2B 91.579 190 10 2 1840 2029 769487997 769487814 9.540000e-65 257.0
8 TraesCS2B01G582000 chr2B 97.500 40 1 0 2027 2066 769334365 769334326 4.800000e-08 69.4
9 TraesCS2B01G582000 chrUn 95.760 1863 24 8 1 1840 316526043 316524213 0.000000e+00 2952.0
10 TraesCS2B01G582000 chrUn 95.760 1863 23 9 1 1840 316534943 316536772 0.000000e+00 2952.0
11 TraesCS2B01G582000 chr2D 89.002 1573 103 33 477 2029 627362271 627360749 0.000000e+00 1882.0
12 TraesCS2B01G582000 chr2D 90.789 152 14 0 2071 2222 627360433 627360282 1.260000e-48 204.0
13 TraesCS2B01G582000 chr2A 85.458 1616 116 61 409 2002 758056698 758055180 0.000000e+00 1572.0
14 TraesCS2B01G582000 chr2A 86.290 372 47 4 2063 2431 757995273 757994903 4.170000e-108 401.0
15 TraesCS2B01G582000 chr2A 92.337 261 19 1 2428 2687 735053948 735054208 1.180000e-98 370.0
16 TraesCS2B01G582000 chr2A 91.250 240 18 3 17 256 758057412 758057176 9.280000e-85 324.0
17 TraesCS2B01G582000 chr3B 94.595 259 14 0 2429 2687 18765054 18765312 4.170000e-108 401.0
18 TraesCS2B01G582000 chr4B 94.094 254 15 0 2434 2687 382212015 382212268 1.170000e-103 387.0
19 TraesCS2B01G582000 chr4A 93.077 260 17 1 2429 2687 24812179 24812438 1.950000e-101 379.0
20 TraesCS2B01G582000 chr3A 93.050 259 18 0 2429 2687 747594311 747594053 1.950000e-101 379.0
21 TraesCS2B01G582000 chr7A 92.045 264 20 1 2425 2687 70233142 70232879 1.180000e-98 370.0
22 TraesCS2B01G582000 chr7A 91.698 265 21 1 2424 2687 106420048 106419784 1.520000e-97 366.0
23 TraesCS2B01G582000 chr7D 82.206 281 40 6 110 390 105252466 105252196 1.610000e-57 233.0
24 TraesCS2B01G582000 chr1A 79.000 300 49 10 86 380 444418347 444418637 2.730000e-45 193.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G582000 chr2B 769427309 769429995 2686 True 4963.0 4963 100.0000 1 2687 1 chr2B.!!$R3 2686
1 TraesCS2B01G582000 chr2B 769377003 769379686 2683 True 4765.0 4765 98.6970 1 2687 1 chr2B.!!$R2 2686
2 TraesCS2B01G582000 chr2B 769306691 769308521 1830 True 2952.0 2952 95.7600 1 1840 1 chr2B.!!$R1 1839
3 TraesCS2B01G582000 chr2B 769476979 769482343 5364 True 1897.0 2780 94.7125 24 2687 2 chr2B.!!$R5 2663
4 TraesCS2B01G582000 chr2B 769334326 769336991 2665 True 1510.7 2952 96.6300 1 2066 2 chr2B.!!$R4 2065
5 TraesCS2B01G582000 chr2B 769487814 769491838 4024 True 842.5 1428 89.3625 546 2029 2 chr2B.!!$R6 1483
6 TraesCS2B01G582000 chrUn 316524213 316526043 1830 True 2952.0 2952 95.7600 1 1840 1 chrUn.!!$R1 1839
7 TraesCS2B01G582000 chrUn 316534943 316536772 1829 False 2952.0 2952 95.7600 1 1840 1 chrUn.!!$F1 1839
8 TraesCS2B01G582000 chr2D 627360282 627362271 1989 True 1043.0 1882 89.8955 477 2222 2 chr2D.!!$R1 1745
9 TraesCS2B01G582000 chr2A 758055180 758057412 2232 True 948.0 1572 88.3540 17 2002 2 chr2A.!!$R2 1985

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
928 2305 5.782845 AGAGAAGAAAAGTCTACCATCACCT 59.217 40.0 0.0 0.0 32.16 4.0 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2566 9010 1.672854 CCCACCTGTCGGATTCGCTA 61.673 60.0 0.0 0.0 36.13 4.26 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
527 854 7.065085 CGAGTGAAATTATGAAGATGTGAGGTT 59.935 37.037 0.00 0.00 0.00 3.50
928 2305 5.782845 AGAGAAGAAAAGTCTACCATCACCT 59.217 40.000 0.00 0.00 32.16 4.00
1586 4665 6.811253 TCATGCGGTTGAGTAATTAAAAGT 57.189 33.333 0.00 0.00 0.00 2.66
1600 4679 8.450964 AGTAATTAAAAGTCGCTGTACGTAGTA 58.549 33.333 0.00 0.00 45.11 1.82
2126 8570 1.610624 GGCCTTGATGGACTCGAACAA 60.611 52.381 0.00 0.00 41.93 2.83
2268 8712 0.461870 CGACGGGATTGATGAAGCCA 60.462 55.000 0.60 0.00 39.63 4.75
2328 8772 4.202040 CCCATTCAATGTACATTGTCGCAT 60.202 41.667 35.74 24.16 46.15 4.73
2390 8834 4.944177 AGCCTAGGGTTTGAACTCTACTA 58.056 43.478 7.93 0.00 40.91 1.82
2566 9010 4.244862 CGTTGCATTTTAGCCCAGAAAAT 58.755 39.130 0.00 0.00 37.04 1.82
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1187 4266 2.047179 GGTCCCAGCCGTTCTGAC 60.047 66.667 3.77 0.00 45.72 3.51
1586 4665 0.376152 GCTGCTACTACGTACAGCGA 59.624 55.000 16.98 7.76 45.23 4.93
2126 8570 1.786937 TTGGCAACCATTTCAGGTGT 58.213 45.000 0.00 0.00 42.25 4.16
2268 8712 7.175119 TCCGTCGACTATGAAGAAATCTATGAT 59.825 37.037 14.70 0.00 0.00 2.45
2540 8984 2.164219 CTGGGCTAAAATGCAACGTCAT 59.836 45.455 0.00 0.00 34.04 3.06
2546 8990 5.418676 GCTATTTTCTGGGCTAAAATGCAA 58.581 37.500 12.68 0.00 37.19 4.08
2550 8994 6.239036 GGATTCGCTATTTTCTGGGCTAAAAT 60.239 38.462 9.49 9.49 39.31 1.82
2566 9010 1.672854 CCCACCTGTCGGATTCGCTA 61.673 60.000 0.00 0.00 36.13 4.26


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.