Multiple sequence alignment - TraesCS2B01G572300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G572300 chr2B 100.000 2769 0 0 1 2769 762072832 762070064 0.000000e+00 5114.0
1 TraesCS2B01G572300 chrUn 99.530 2340 11 0 430 2769 342645456 342643117 0.000000e+00 4261.0
2 TraesCS2B01G572300 chrUn 98.974 2340 14 2 430 2769 343021006 343018677 0.000000e+00 4180.0
3 TraesCS2B01G572300 chrUn 99.152 1061 9 0 1709 2769 440176042 440177102 0.000000e+00 1910.0
4 TraesCS2B01G572300 chrUn 88.801 1393 136 13 901 2283 338975300 338976682 0.000000e+00 1690.0
5 TraesCS2B01G572300 chrUn 88.801 1393 136 13 901 2283 342893153 342894535 0.000000e+00 1690.0
6 TraesCS2B01G572300 chrUn 84.950 1608 182 37 709 2281 314618794 314617212 0.000000e+00 1574.0
7 TraesCS2B01G572300 chrUn 82.979 141 22 2 389 527 329049924 329049784 2.900000e-25 126.0
8 TraesCS2B01G572300 chr2D 92.707 1906 116 13 869 2769 621140962 621139075 0.000000e+00 2728.0
9 TraesCS2B01G572300 chr2D 89.250 1600 134 25 544 2125 621265961 621264382 0.000000e+00 1967.0
10 TraesCS2B01G572300 chr2D 84.816 1607 180 39 709 2281 621129908 621128332 0.000000e+00 1557.0
11 TraesCS2B01G572300 chr2D 84.621 1450 164 29 709 2125 621313816 621312393 0.000000e+00 1387.0
12 TraesCS2B01G572300 chr2D 89.623 530 22 6 126 652 621150798 621150299 0.000000e+00 643.0
13 TraesCS2B01G572300 chr2D 92.797 236 15 2 114 348 621266292 621266058 9.500000e-90 340.0
14 TraesCS2B01G572300 chr2D 93.182 176 10 1 644 819 621142816 621142643 9.840000e-65 257.0
15 TraesCS2B01G572300 chr2D 97.143 105 2 1 424 527 621266053 621265949 2.830000e-40 176.0
16 TraesCS2B01G572300 chr2D 73.922 487 93 24 2293 2758 621451359 621451832 6.140000e-37 165.0
17 TraesCS2B01G572300 chr2D 100.000 41 0 0 1 41 621151350 621151310 2.960000e-10 76.8
18 TraesCS2B01G572300 chr2D 100.000 41 0 0 1 41 621266830 621266790 2.960000e-10 76.8
19 TraesCS2B01G572300 chr2D 100.000 34 0 0 836 869 621141088 621141055 2.300000e-06 63.9
20 TraesCS2B01G572300 chr2A 92.473 1581 102 11 1195 2769 753041810 753040241 0.000000e+00 2244.0
21 TraesCS2B01G572300 chr2A 93.674 1154 69 3 819 1972 753053455 753052306 0.000000e+00 1724.0
22 TraesCS2B01G572300 chr2A 89.624 559 39 6 2213 2769 753052299 753051758 0.000000e+00 693.0
23 TraesCS2B01G572300 chr2A 89.358 545 24 6 280 822 753058891 753058379 0.000000e+00 654.0
24 TraesCS2B01G572300 chr2A 97.101 138 4 0 123 260 753059546 753059409 1.660000e-57 233.0
25 TraesCS2B01G572300 chr2A 97.561 41 1 0 1 41 752997922 752997882 1.380000e-08 71.3
26 TraesCS2B01G572300 chr5B 80.191 419 72 9 2343 2758 491113874 491114284 1.250000e-78 303.0
27 TraesCS2B01G572300 chr3B 77.667 403 80 9 2361 2759 590606816 590606420 1.280000e-58 237.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G572300 chr2B 762070064 762072832 2768 True 5114.00 5114 100.000000 1 2769 1 chr2B.!!$R1 2768
1 TraesCS2B01G572300 chrUn 342643117 342645456 2339 True 4261.00 4261 99.530000 430 2769 1 chrUn.!!$R3 2339
2 TraesCS2B01G572300 chrUn 343018677 343021006 2329 True 4180.00 4180 98.974000 430 2769 1 chrUn.!!$R4 2339
3 TraesCS2B01G572300 chrUn 440176042 440177102 1060 False 1910.00 1910 99.152000 1709 2769 1 chrUn.!!$F3 1060
4 TraesCS2B01G572300 chrUn 338975300 338976682 1382 False 1690.00 1690 88.801000 901 2283 1 chrUn.!!$F1 1382
5 TraesCS2B01G572300 chrUn 342893153 342894535 1382 False 1690.00 1690 88.801000 901 2283 1 chrUn.!!$F2 1382
6 TraesCS2B01G572300 chrUn 314617212 314618794 1582 True 1574.00 1574 84.950000 709 2281 1 chrUn.!!$R1 1572
7 TraesCS2B01G572300 chr2D 621128332 621129908 1576 True 1557.00 1557 84.816000 709 2281 1 chr2D.!!$R1 1572
8 TraesCS2B01G572300 chr2D 621312393 621313816 1423 True 1387.00 1387 84.621000 709 2125 1 chr2D.!!$R2 1416
9 TraesCS2B01G572300 chr2D 621139075 621142816 3741 True 1016.30 2728 95.296333 644 2769 3 chr2D.!!$R3 2125
10 TraesCS2B01G572300 chr2D 621264382 621266830 2448 True 639.95 1967 94.797500 1 2125 4 chr2D.!!$R5 2124
11 TraesCS2B01G572300 chr2D 621150299 621151350 1051 True 359.90 643 94.811500 1 652 2 chr2D.!!$R4 651
12 TraesCS2B01G572300 chr2A 753040241 753041810 1569 True 2244.00 2244 92.473000 1195 2769 1 chr2A.!!$R2 1574
13 TraesCS2B01G572300 chr2A 753051758 753053455 1697 True 1208.50 1724 91.649000 819 2769 2 chr2A.!!$R3 1950
14 TraesCS2B01G572300 chr2A 753058379 753059546 1167 True 443.50 654 93.229500 123 822 2 chr2A.!!$R4 699

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
395 1325 0.463116 GTGTGGTCCTTTGTGTCCGT 60.463 55.0 0.0 0.0 0.0 4.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2185 4793 1.757118 CTGAACGATGGGGCTTAGAGA 59.243 52.381 0.0 0.0 0.0 3.1 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
260 691 3.947910 AATCGTCCGTAAAAGGTCTCA 57.052 42.857 0.0 0.0 0.00 3.27
261 692 3.505464 ATCGTCCGTAAAAGGTCTCAG 57.495 47.619 0.0 0.0 0.00 3.35
318 1247 6.830324 ACATGAGCAACTATTATTGACCACAT 59.170 34.615 0.0 0.0 0.00 3.21
348 1277 0.598562 AGCTGACGACGATCACTGTT 59.401 50.000 0.0 0.0 0.00 3.16
360 1289 5.308825 ACGATCACTGTTCTTTTCTTGGAT 58.691 37.500 0.0 0.0 0.00 3.41
365 1294 7.912056 TCACTGTTCTTTTCTTGGATAGATG 57.088 36.000 0.0 0.0 31.54 2.90
395 1325 0.463116 GTGTGGTCCTTTGTGTCCGT 60.463 55.000 0.0 0.0 0.00 4.69
417 1347 2.192664 TCCAAATCTAGGCACGCAAA 57.807 45.000 0.0 0.0 0.00 3.68
1806 4406 4.269363 CCTGAAACACGTTCGTTCTAAACT 59.731 41.667 0.0 0.0 39.30 2.66
2185 4793 2.843113 CTGAGAGACCAAAATCTCCCCT 59.157 50.000 0.0 0.0 45.43 4.79
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
120 551 7.739022 ACACATGCGTAAAACATATCAATTG 57.261 32.000 0.00 0.0 0.00 2.32
121 552 9.847706 TTTACACATGCGTAAAACATATCAATT 57.152 25.926 14.99 0.0 38.17 2.32
331 1260 2.620779 AGAACAGTGATCGTCGTCAG 57.379 50.000 0.00 0.0 0.00 3.51
348 1277 7.331026 CAGTGTACCATCTATCCAAGAAAAGA 58.669 38.462 0.00 0.0 37.89 2.52
385 1314 3.750371 AGATTTGGATCACGGACACAAA 58.250 40.909 0.00 0.0 35.76 2.83
395 1325 1.209261 TGCGTGCCTAGATTTGGATCA 59.791 47.619 0.00 0.0 34.60 2.92
1806 4406 3.857157 ACAAAAGTCTGGGCTCTTACA 57.143 42.857 0.00 0.0 0.00 2.41
2185 4793 1.757118 CTGAACGATGGGGCTTAGAGA 59.243 52.381 0.00 0.0 0.00 3.10


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.