Multiple sequence alignment - TraesCS2B01G570200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G570200 chr2B 100.000 2558 0 0 1 2558 760900738 760898181 0 4724
1 TraesCS2B01G570200 chrUn 98.632 2559 34 1 1 2558 246703761 246701203 0 4530
2 TraesCS2B01G570200 chr6B 98.632 2558 35 0 1 2558 128896748 128894191 0 4530
3 TraesCS2B01G570200 chr7B 98.593 2558 36 0 1 2558 698133376 698130819 0 4525
4 TraesCS2B01G570200 chr7B 98.397 2558 41 0 1 2558 742930720 742933277 0 4497
5 TraesCS2B01G570200 chr7B 97.928 2558 53 0 1 2558 716802610 716800053 0 4431
6 TraesCS2B01G570200 chr3D 98.163 2558 46 1 1 2558 202630985 202628429 0 4462
7 TraesCS2B01G570200 chr5B 98.006 2558 49 2 1 2558 127825763 127823208 0 4440
8 TraesCS2B01G570200 chr5B 97.928 2558 52 1 1 2558 713088996 713091552 0 4429
9 TraesCS2B01G570200 chr5B 97.811 2558 55 1 1 2558 713119730 713117174 0 4412


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G570200 chr2B 760898181 760900738 2557 True 4724 4724 100.000 1 2558 1 chr2B.!!$R1 2557
1 TraesCS2B01G570200 chrUn 246701203 246703761 2558 True 4530 4530 98.632 1 2558 1 chrUn.!!$R1 2557
2 TraesCS2B01G570200 chr6B 128894191 128896748 2557 True 4530 4530 98.632 1 2558 1 chr6B.!!$R1 2557
3 TraesCS2B01G570200 chr7B 698130819 698133376 2557 True 4525 4525 98.593 1 2558 1 chr7B.!!$R1 2557
4 TraesCS2B01G570200 chr7B 742930720 742933277 2557 False 4497 4497 98.397 1 2558 1 chr7B.!!$F1 2557
5 TraesCS2B01G570200 chr7B 716800053 716802610 2557 True 4431 4431 97.928 1 2558 1 chr7B.!!$R2 2557
6 TraesCS2B01G570200 chr3D 202628429 202630985 2556 True 4462 4462 98.163 1 2558 1 chr3D.!!$R1 2557
7 TraesCS2B01G570200 chr5B 127823208 127825763 2555 True 4440 4440 98.006 1 2558 1 chr5B.!!$R1 2557
8 TraesCS2B01G570200 chr5B 713088996 713091552 2556 False 4429 4429 97.928 1 2558 1 chr5B.!!$F1 2557
9 TraesCS2B01G570200 chr5B 713117174 713119730 2556 True 4412 4412 97.811 1 2558 1 chr5B.!!$R2 2557

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
552 554 0.035739 TGCCCGGAAACAACTCCTAC 59.964 55.0 0.73 0.0 32.82 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2085 2087 1.615392 GAAACCAGCAGCTTGAACCAT 59.385 47.619 0.0 0.0 0.0 3.55 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
155 156 0.989602 CTAAAAAGGACCCTCCCCGT 59.010 55.000 0.00 0.00 37.19 5.28
450 452 1.799548 CGGGAACAACAAAAACCACCG 60.800 52.381 0.00 0.00 0.00 4.94
483 485 2.347731 CTTTCTTCGGTGCTACCTTCC 58.652 52.381 4.21 0.00 35.66 3.46
552 554 0.035739 TGCCCGGAAACAACTCCTAC 59.964 55.000 0.73 0.00 32.82 3.18
1232 1234 4.799564 TTGGAAGATATGGCACCAAAAC 57.200 40.909 2.80 0.00 37.62 2.43
1234 1236 3.763360 TGGAAGATATGGCACCAAAACTG 59.237 43.478 0.00 0.00 0.00 3.16
1298 1300 1.202486 TCGGGCTACAATCGGACAATC 60.202 52.381 0.00 0.00 0.00 2.67
1323 1325 1.665679 CGTGCTATGAGCGGACAATTT 59.334 47.619 0.00 0.00 46.26 1.82
1548 1550 4.023107 TGTTCGTCAACCAAGTTTGTTCAA 60.023 37.500 0.00 0.00 0.00 2.69
1641 1643 3.412386 CCTGAACGAGGAAAGTGGAAAT 58.588 45.455 0.00 0.00 46.33 2.17
1659 1661 5.917087 TGGAAATACAAAGAGGGATAGGGAT 59.083 40.000 0.00 0.00 0.00 3.85
1723 1725 2.290896 CCCTTCTTGTTCCAGGCATACA 60.291 50.000 0.00 0.00 0.00 2.29
1898 1900 1.934220 CTGATTGCTGTGGCTGCAGG 61.934 60.000 17.12 0.00 39.29 4.85
2018 2020 4.473444 AGTTCCTGATGGTCATGTTTGTT 58.527 39.130 0.00 0.00 34.23 2.83
2245 2247 9.092876 TGCTTTTGTTAATAAAAAGTTGAGTGG 57.907 29.630 19.40 5.99 43.47 4.00
2477 2479 5.297029 CCACTCACTATCGTCATCTTGTAGA 59.703 44.000 0.00 0.00 0.00 2.59
2480 2482 6.374613 ACTCACTATCGTCATCTTGTAGACAA 59.625 38.462 0.00 0.00 34.48 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
155 156 2.424842 ATTCAAGGAGGGGCGCACAA 62.425 55.000 13.89 0.00 0.00 3.33
450 452 3.552294 CCGAAGAAAGGAAAGAGCGATAC 59.448 47.826 0.00 0.00 0.00 2.24
552 554 8.624776 GTTCCTACATTTGATCCTAAATTGAGG 58.375 37.037 1.78 1.78 38.03 3.86
629 631 8.224720 CCCTTTATCAATTTTCCTATCCTACCA 58.775 37.037 0.00 0.00 0.00 3.25
700 702 6.343716 TCAAATAAGAGTTGTACCCGTACA 57.656 37.500 3.57 3.57 43.61 2.90
1232 1234 1.178276 AAGACGACCAGCTCTACCAG 58.822 55.000 0.00 0.00 0.00 4.00
1234 1236 1.544691 TGAAAGACGACCAGCTCTACC 59.455 52.381 0.00 0.00 0.00 3.18
1298 1300 1.665916 CCGCTCATAGCACGATGGG 60.666 63.158 0.00 0.00 42.58 4.00
1323 1325 9.542462 CTTACCCATATCTTACAATTTCTTCGA 57.458 33.333 0.00 0.00 0.00 3.71
1356 1358 2.900546 CCCCGTAATAGGAAGATCTGCT 59.099 50.000 0.00 0.00 0.00 4.24
1548 1550 5.577945 CACTAACCAATTACGTTACGACCAT 59.422 40.000 13.03 0.00 0.00 3.55
1631 1633 7.119387 CCTATCCCTCTTTGTATTTCCACTTT 58.881 38.462 0.00 0.00 0.00 2.66
1641 1643 4.408276 CGAGATCCCTATCCCTCTTTGTA 58.592 47.826 0.00 0.00 31.98 2.41
1723 1725 1.831286 ACCGTCACGTCTCAGGGTT 60.831 57.895 0.00 0.00 0.00 4.11
1898 1900 3.525537 TGAGAGATTTGCCAAGATCGAC 58.474 45.455 0.00 0.00 0.00 4.20
2085 2087 1.615392 GAAACCAGCAGCTTGAACCAT 59.385 47.619 0.00 0.00 0.00 3.55
2245 2247 5.571784 TCAATCTGACATCTTGAATTGCC 57.428 39.130 0.00 0.00 0.00 4.52
2459 2461 5.652891 AGGTTGTCTACAAGATGACGATAGT 59.347 40.000 0.00 0.00 45.31 2.12


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.