Multiple sequence alignment - TraesCS2B01G544900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G544900 chr2B 100.000 2663 0 0 1 2663 741912319 741909657 0 4918
1 TraesCS2B01G544900 chr2B 98.612 2665 32 5 1 2663 608457625 608460286 0 4711
2 TraesCS2B01G544900 chr2B 98.274 2665 42 4 1 2663 99567815 99565153 0 4663
3 TraesCS2B01G544900 chr2A 98.724 2664 30 4 3 2663 389206957 389209619 0 4728
4 TraesCS2B01G544900 chr5A 98.424 2665 39 3 1 2663 9628676 9626013 0 4686
5 TraesCS2B01G544900 chr5A 98.274 2665 40 6 1 2663 294236752 294234092 0 4662


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G544900 chr2B 741909657 741912319 2662 True 4918 4918 100.000 1 2663 1 chr2B.!!$R2 2662
1 TraesCS2B01G544900 chr2B 608457625 608460286 2661 False 4711 4711 98.612 1 2663 1 chr2B.!!$F1 2662
2 TraesCS2B01G544900 chr2B 99565153 99567815 2662 True 4663 4663 98.274 1 2663 1 chr2B.!!$R1 2662
3 TraesCS2B01G544900 chr2A 389206957 389209619 2662 False 4728 4728 98.724 3 2663 1 chr2A.!!$F1 2660
4 TraesCS2B01G544900 chr5A 9626013 9628676 2663 True 4686 4686 98.424 1 2663 1 chr5A.!!$R1 2662
5 TraesCS2B01G544900 chr5A 294234092 294236752 2660 True 4662 4662 98.274 1 2663 1 chr5A.!!$R2 2662

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
506 508 0.395311 CACCTCCAGGCAGCAATCAT 60.395 55.0 0.0 0.0 39.32 2.45 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2163 2170 1.539827 GGGTTGTTCGCACTGCTTAAT 59.46 47.619 0.0 0.0 0.0 1.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
186 187 0.533032 TGGCGTTGATGTCATACCGA 59.467 50.000 3.26 0.00 0.00 4.69
319 320 7.872993 GGAGAGGAACATGATATACGATTTTCA 59.127 37.037 0.00 0.00 0.00 2.69
506 508 0.395311 CACCTCCAGGCAGCAATCAT 60.395 55.000 0.00 0.00 39.32 2.45
648 650 3.854459 GCCTAGTTGCGCACGCTC 61.854 66.667 11.12 9.32 42.51 5.03
675 677 7.119116 TGTTAGTTCACGCATCAAAGATAACAT 59.881 33.333 0.00 0.00 0.00 2.71
925 927 2.756760 CACCGAACAGGCTACCTAGTTA 59.243 50.000 0.00 0.00 46.52 2.24
1113 1116 3.453353 GGCTCATAACCCAGGTTAGTACA 59.547 47.826 14.30 0.00 42.82 2.90
1262 1265 7.333528 TCTAACTTGTTTTTCATGTTCTGCT 57.666 32.000 0.00 0.00 41.40 4.24
1371 1374 5.719173 AGTTGCACAAAAATGTACTGTGTT 58.281 33.333 12.23 0.00 41.99 3.32
1848 1854 1.938625 CCTTTGTTGGCAACTGGTTG 58.061 50.000 28.71 14.77 43.14 3.77
2555 2565 5.164620 TGTCAATAATCTGGAAGTGCTCA 57.835 39.130 0.00 0.00 33.76 4.26
2570 2580 2.035066 GTGCTCAATGCTGAACTTTGGT 59.965 45.455 0.00 0.00 43.37 3.67
2618 2628 2.589540 CCCGCAATGGTAGAGGCA 59.410 61.111 0.00 0.00 35.15 4.75
2627 2637 4.142093 GCAATGGTAGAGGCATTGTTCATT 60.142 41.667 0.00 0.00 38.26 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
186 187 2.636403 ACCGTCTTAGCAGGTACCTTTT 59.364 45.455 13.15 5.88 36.34 2.27
506 508 0.030195 TACCTGGATGATGAGCCCCA 60.030 55.000 0.00 0.00 0.00 4.96
648 650 4.990543 TCTTTGATGCGTGAACTAACAG 57.009 40.909 0.00 0.00 0.00 3.16
843 845 1.455822 AGTTTGATGGGGAGTTGGGA 58.544 50.000 0.00 0.00 0.00 4.37
925 927 0.790207 CGAACTAACACAGCATGCGT 59.210 50.000 13.01 10.68 42.53 5.24
1113 1116 4.993029 TTTTGTTTTGGAGTCGGTGAAT 57.007 36.364 0.00 0.00 0.00 2.57
1262 1265 3.704566 ACTTGGATTGTAGTCGCCTATGA 59.295 43.478 0.00 0.00 0.00 2.15
2009 2016 3.757493 CGACAAGGAGTAGGTCAGTACTT 59.243 47.826 0.00 0.00 33.18 2.24
2163 2170 1.539827 GGGTTGTTCGCACTGCTTAAT 59.460 47.619 0.00 0.00 0.00 1.40
2555 2565 5.473066 AGCATTAACCAAAGTTCAGCATT 57.527 34.783 0.00 0.00 37.42 3.56
2627 2637 1.001974 ACGCTGGACAACATTGAGCTA 59.998 47.619 0.00 0.00 0.00 3.32


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.