Multiple sequence alignment - TraesCS2B01G540800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G540800 chr2B 100.000 2849 0 0 1 2849 737227857 737225009 0.000000e+00 5262
1 TraesCS2B01G540800 chr2B 99.123 2850 22 3 1 2849 737246911 737244064 0.000000e+00 5121
2 TraesCS2B01G540800 chr2B 93.610 1252 57 11 621 1863 737097443 737096206 0.000000e+00 1847
3 TraesCS2B01G540800 chr2B 91.374 1252 68 12 621 1863 737108704 737107484 0.000000e+00 1677
4 TraesCS2B01G540800 chr2B 90.449 1204 65 18 673 1863 737160815 737159649 0.000000e+00 1541
5 TraesCS2B01G540800 chr2B 90.951 1094 71 7 771 1863 737272390 737271324 0.000000e+00 1447
6 TraesCS2B01G540800 chr2B 82.459 610 70 20 17 612 583670727 583670141 1.520000e-137 499
7 TraesCS2B01G540800 chr2B 88.020 409 32 12 1966 2368 737159651 737159254 4.300000e-128 468
8 TraesCS2B01G540800 chr2B 88.669 353 23 10 1966 2316 737096208 737095871 5.680000e-112 414
9 TraesCS2B01G540800 chr2B 94.211 190 9 2 2661 2849 12913579 12913391 3.590000e-74 289
10 TraesCS2B01G540800 chr2A 94.239 1215 57 7 653 1863 737735489 737734284 0.000000e+00 1844
11 TraesCS2B01G540800 chr2A 92.173 1201 78 7 672 1863 737880627 737879434 0.000000e+00 1683
12 TraesCS2B01G540800 chr2A 92.497 853 52 5 672 1518 737838564 737837718 0.000000e+00 1210
13 TraesCS2B01G540800 chr2A 81.926 675 77 31 1970 2626 737734283 737733636 1.940000e-146 529
14 TraesCS2B01G540800 chr2A 89.499 419 26 11 1966 2379 738005945 738005540 5.440000e-142 514
15 TraesCS2B01G540800 chr2A 89.109 404 27 9 1970 2368 737879433 737879042 1.190000e-133 486
16 TraesCS2B01G540800 chr2A 84.615 247 34 4 2382 2626 737836947 737836703 2.840000e-60 243
17 TraesCS2B01G540800 chr2A 84.615 247 34 4 2382 2626 737878987 737878743 2.840000e-60 243
18 TraesCS2B01G540800 chr2A 97.297 111 3 0 1862 1972 762743750 762743640 3.750000e-44 189
19 TraesCS2B01G540800 chr2A 87.640 89 8 3 2372 2459 738005508 738005422 1.810000e-17 100
20 TraesCS2B01G540800 chr2D 95.358 991 46 0 834 1824 606188757 606187767 0.000000e+00 1576
21 TraesCS2B01G540800 chr2D 90.123 1215 89 11 672 1863 606156651 606155445 0.000000e+00 1550
22 TraesCS2B01G540800 chr2D 92.183 985 37 9 672 1651 606164505 606163556 0.000000e+00 1356
23 TraesCS2B01G540800 chr2D 90.976 410 25 7 1970 2377 606161873 606161474 2.500000e-150 542
24 TraesCS2B01G540800 chr2D 90.315 413 28 7 1966 2377 606155447 606155046 5.400000e-147 531
25 TraesCS2B01G540800 chr2D 87.938 257 15 5 2370 2626 606155014 606154774 3.590000e-74 289
26 TraesCS2B01G540800 chr2D 86.381 257 19 5 2370 2626 606161442 606161202 1.680000e-67 267
27 TraesCS2B01G540800 chr2D 91.954 174 4 4 672 840 606189109 606188941 4.750000e-58 235
28 TraesCS2B01G540800 chr2D 83.616 177 23 5 2665 2835 499149706 499149530 8.170000e-36 161
29 TraesCS2B01G540800 chrUn 89.356 404 26 9 1970 2368 386124774 386124383 2.550000e-135 492
30 TraesCS2B01G540800 chrUn 84.615 247 34 4 2382 2626 386124328 386124084 2.840000e-60 243
31 TraesCS2B01G540800 chrUn 95.575 113 5 0 1858 1970 322990766 322990654 6.270000e-42 182
32 TraesCS2B01G540800 chr1B 83.014 418 43 16 1 410 368077386 368077783 1.260000e-93 353
33 TraesCS2B01G540800 chr5D 80.573 489 53 24 1 476 113748395 113748854 3.520000e-89 339
34 TraesCS2B01G540800 chr5D 93.158 190 11 2 2661 2849 393542262 393542450 7.770000e-71 278
35 TraesCS2B01G540800 chr5D 86.528 193 23 3 2659 2849 543203997 543204188 2.880000e-50 209
36 TraesCS2B01G540800 chr3B 77.673 636 81 31 1 616 727054165 727053571 5.880000e-87 331
37 TraesCS2B01G540800 chr6B 93.229 192 10 3 2659 2849 577417403 577417214 2.160000e-71 279
38 TraesCS2B01G540800 chr6B 79.487 156 21 9 18 166 392487580 392487731 1.810000e-17 100
39 TraesCS2B01G540800 chr3A 98.182 110 2 0 1861 1970 564540104 564540213 2.900000e-45 193
40 TraesCS2B01G540800 chr4A 97.273 110 3 0 1861 1970 182414666 182414557 1.350000e-43 187
41 TraesCS2B01G540800 chr4A 97.248 109 3 0 1861 1969 649897987 649897879 4.850000e-43 185
42 TraesCS2B01G540800 chr7A 95.652 115 5 0 1859 1973 5051105 5051219 4.850000e-43 185
43 TraesCS2B01G540800 chr6D 95.575 113 5 0 1863 1975 112344482 112344370 6.270000e-42 182
44 TraesCS2B01G540800 chr6D 78.788 264 48 7 1 260 23056689 23056948 1.360000e-38 171
45 TraesCS2B01G540800 chr5B 92.683 123 7 1 1863 1985 531200433 531200313 2.920000e-40 176
46 TraesCS2B01G540800 chr5B 77.328 247 42 12 6 249 666123568 666123333 1.780000e-27 134


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G540800 chr2B 737225009 737227857 2848 True 5262.000000 5262 100.000000 1 2849 1 chr2B.!!$R4 2848
1 TraesCS2B01G540800 chr2B 737244064 737246911 2847 True 5121.000000 5121 99.123000 1 2849 1 chr2B.!!$R5 2848
2 TraesCS2B01G540800 chr2B 737107484 737108704 1220 True 1677.000000 1677 91.374000 621 1863 1 chr2B.!!$R3 1242
3 TraesCS2B01G540800 chr2B 737271324 737272390 1066 True 1447.000000 1447 90.951000 771 1863 1 chr2B.!!$R6 1092
4 TraesCS2B01G540800 chr2B 737095871 737097443 1572 True 1130.500000 1847 91.139500 621 2316 2 chr2B.!!$R7 1695
5 TraesCS2B01G540800 chr2B 737159254 737160815 1561 True 1004.500000 1541 89.234500 673 2368 2 chr2B.!!$R8 1695
6 TraesCS2B01G540800 chr2B 583670141 583670727 586 True 499.000000 499 82.459000 17 612 1 chr2B.!!$R2 595
7 TraesCS2B01G540800 chr2A 737733636 737735489 1853 True 1186.500000 1844 88.082500 653 2626 2 chr2A.!!$R2 1973
8 TraesCS2B01G540800 chr2A 737878743 737880627 1884 True 804.000000 1683 88.632333 672 2626 3 chr2A.!!$R4 1954
9 TraesCS2B01G540800 chr2A 737836703 737838564 1861 True 726.500000 1210 88.556000 672 2626 2 chr2A.!!$R3 1954
10 TraesCS2B01G540800 chr2A 738005422 738005945 523 True 307.000000 514 88.569500 1966 2459 2 chr2A.!!$R5 493
11 TraesCS2B01G540800 chr2D 606187767 606189109 1342 True 905.500000 1576 93.656000 672 1824 2 chr2D.!!$R4 1152
12 TraesCS2B01G540800 chr2D 606154774 606156651 1877 True 790.000000 1550 89.458667 672 2626 3 chr2D.!!$R2 1954
13 TraesCS2B01G540800 chr2D 606161202 606164505 3303 True 721.666667 1356 89.846667 672 2626 3 chr2D.!!$R3 1954
14 TraesCS2B01G540800 chrUn 386124084 386124774 690 True 367.500000 492 86.985500 1970 2626 2 chrUn.!!$R2 656
15 TraesCS2B01G540800 chr3B 727053571 727054165 594 True 331.000000 331 77.673000 1 616 1 chr3B.!!$R1 615

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
173 178 0.394352 ACAAAGCCATAGCGGGAAGG 60.394 55.0 0.0 0.0 46.67 3.46 F
1419 1680 0.032515 TCTCCCACCTAGATCGCCAA 60.033 55.0 0.0 0.0 0.00 4.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1655 1916 0.249073 GATCTCCATCACGTCACCGG 60.249 60.000 0.0 0.00 38.78 5.28 R
2301 4044 2.016096 TCTTCCCCTAGGAGGAGGAAA 58.984 52.381 21.4 10.17 43.04 3.13 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
173 178 0.394352 ACAAAGCCATAGCGGGAAGG 60.394 55.000 0.00 0.0 46.67 3.46
285 293 2.048877 CGTCGCCTTAACGTGGGT 60.049 61.111 0.00 0.0 35.47 4.51
437 445 3.364549 TCGATTGGAATTGGAGGCAAAT 58.635 40.909 0.00 0.0 0.00 2.32
440 448 4.202182 CGATTGGAATTGGAGGCAAATGAT 60.202 41.667 0.00 0.0 0.00 2.45
612 632 5.440685 CCGGCTGTCGATTATAAATGTTTC 58.559 41.667 1.87 0.0 42.43 2.78
1419 1680 0.032515 TCTCCCACCTAGATCGCCAA 60.033 55.000 0.00 0.0 0.00 4.52
1655 1916 1.786579 CAAAAACTGCGGCTTTAGTGC 59.213 47.619 0.00 0.0 0.00 4.40
1812 3537 4.192317 CCCATGCTCTAGTAGTTTCCAAC 58.808 47.826 0.00 0.0 0.00 3.77
1953 3684 6.316390 ACATCCATTTCCGAGACAAGTAATTC 59.684 38.462 0.00 0.0 0.00 2.17
2301 4044 2.165167 CATTTGTGCATGAGGACCAGT 58.835 47.619 0.00 0.0 34.84 4.00
2379 4161 1.809684 CTCCTCTCGTGTTTTTCCCC 58.190 55.000 0.00 0.0 0.00 4.81
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
13 14 2.608090 GCCGGTAGTAGCTTTTCACATC 59.392 50.000 1.90 0.00 0.00 3.06
15 16 1.621814 AGCCGGTAGTAGCTTTTCACA 59.378 47.619 1.90 0.00 35.22 3.58
152 157 2.639065 CTTCCCGCTATGGCTTTGTTA 58.361 47.619 0.00 0.00 35.87 2.41
437 445 2.316067 TCTTTCCCCTCTCTCTCCATCA 59.684 50.000 0.00 0.00 0.00 3.07
440 448 3.275848 TTTCTTTCCCCTCTCTCTCCA 57.724 47.619 0.00 0.00 0.00 3.86
1655 1916 0.249073 GATCTCCATCACGTCACCGG 60.249 60.000 0.00 0.00 38.78 5.28
1666 2384 2.686118 GCTTGAAAGCCCAGATCTCCAT 60.686 50.000 3.56 0.00 46.20 3.41
1812 3537 1.272490 TGTGCTGTTTCCTCTACTCCG 59.728 52.381 0.00 0.00 0.00 4.63
1953 3684 4.319177 CAAGAACTACTCCCTCTGTTTGG 58.681 47.826 0.00 0.00 0.00 3.28
2301 4044 2.016096 TCTTCCCCTAGGAGGAGGAAA 58.984 52.381 21.40 10.17 43.04 3.13
2379 4161 4.616181 AGAGTTTGAAAACGGAACACAG 57.384 40.909 0.48 0.00 43.51 3.66


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.