Multiple sequence alignment - TraesCS2B01G527000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G527000 chr2B 100.000 2357 0 0 1 2357 721362375 721360019 0 4353
1 TraesCS2B01G527000 chr1A 98.346 2358 36 3 1 2357 491377762 491380117 0 4135
2 TraesCS2B01G527000 chr1B 98.304 2359 38 2 1 2357 636803885 636806243 0 4133
3 TraesCS2B01G527000 chr1B 98.288 1986 32 2 374 2357 664798171 664796186 0 3478
4 TraesCS2B01G527000 chr1B 98.638 661 9 0 1 661 659750629 659751289 0 1171
5 TraesCS2B01G527000 chr5A 98.176 2358 41 2 1 2357 522984865 522987221 0 4115
6 TraesCS2B01G527000 chr2A 98.177 2359 40 3 1 2357 41620092 41617735 0 4115
7 TraesCS2B01G527000 chr5B 98.454 2329 35 1 30 2357 375732632 375730304 0 4100
8 TraesCS2B01G527000 chr5B 97.880 2358 48 2 1 2357 606865446 606863090 0 4076
9 TraesCS2B01G527000 chr5B 97.752 2358 50 3 1 2357 503878168 503880523 0 4058
10 TraesCS2B01G527000 chr6B 97.753 2359 46 5 3 2357 675570296 675572651 0 4056


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G527000 chr2B 721360019 721362375 2356 True 4353 4353 100.000 1 2357 1 chr2B.!!$R1 2356
1 TraesCS2B01G527000 chr1A 491377762 491380117 2355 False 4135 4135 98.346 1 2357 1 chr1A.!!$F1 2356
2 TraesCS2B01G527000 chr1B 636803885 636806243 2358 False 4133 4133 98.304 1 2357 1 chr1B.!!$F1 2356
3 TraesCS2B01G527000 chr1B 664796186 664798171 1985 True 3478 3478 98.288 374 2357 1 chr1B.!!$R1 1983
4 TraesCS2B01G527000 chr1B 659750629 659751289 660 False 1171 1171 98.638 1 661 1 chr1B.!!$F2 660
5 TraesCS2B01G527000 chr5A 522984865 522987221 2356 False 4115 4115 98.176 1 2357 1 chr5A.!!$F1 2356
6 TraesCS2B01G527000 chr2A 41617735 41620092 2357 True 4115 4115 98.177 1 2357 1 chr2A.!!$R1 2356
7 TraesCS2B01G527000 chr5B 375730304 375732632 2328 True 4100 4100 98.454 30 2357 1 chr5B.!!$R1 2327
8 TraesCS2B01G527000 chr5B 606863090 606865446 2356 True 4076 4076 97.880 1 2357 1 chr5B.!!$R2 2356
9 TraesCS2B01G527000 chr5B 503878168 503880523 2355 False 4058 4058 97.752 1 2357 1 chr5B.!!$F1 2356
10 TraesCS2B01G527000 chr6B 675570296 675572651 2355 False 4056 4056 97.753 3 2357 1 chr6B.!!$F1 2354

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
770 776 2.219875 CCTGGAGTGGCAGTCCTGT 61.22 63.158 34.74 0.0 38.55 4.0 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1741 1754 1.661341 GGCAAGAGTTCTGCATCGAT 58.339 50.0 0.0 0.0 0.0 3.59 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
523 527 2.880890 CTGCTTTTGGTTCTGTAGTGCT 59.119 45.455 0.00 0.0 0.00 4.40
770 776 2.219875 CCTGGAGTGGCAGTCCTGT 61.220 63.158 34.74 0.0 38.55 4.00
778 784 2.555547 GGCAGTCCTGTGGTGTTGC 61.556 63.158 0.00 0.0 0.00 4.17
902 908 3.746045 TTTCAGAGTACGACAAGCCTT 57.254 42.857 0.00 0.0 0.00 4.35
1741 1754 0.394192 GGCATCATCGTCATCCTCCA 59.606 55.000 0.00 0.0 0.00 3.86
1876 1889 1.522668 CTTTGACGATGCAGAACCCA 58.477 50.000 0.00 0.0 0.00 4.51
2009 2022 2.311542 TCCACCTTGCATCCAACCTAAT 59.688 45.455 0.00 0.0 0.00 1.73
2019 2032 7.156876 TGCATCCAACCTAATAAGTTCTTTG 57.843 36.000 0.00 0.0 0.00 2.77
2059 2072 0.253160 TTCAGGCCACCCAGACCTAT 60.253 55.000 5.01 0.0 30.84 2.57
2257 2270 2.093658 GCTTATCCACCTCCGTCTGAAA 60.094 50.000 0.00 0.0 0.00 2.69
2261 2274 1.376037 CACCTCCGTCTGAAAGGGC 60.376 63.158 6.87 0.0 34.31 5.19
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
112 113 4.007644 TCGGCCAGCACTGTCAGG 62.008 66.667 2.24 0.0 0.00 3.86
523 527 7.016268 GGATATTTTAGGATCCCTGTAGTGTCA 59.984 40.741 8.55 0.0 36.39 3.58
677 681 5.245531 AGGCAAACTCATATCGACTGAAAA 58.754 37.500 0.00 0.0 0.00 2.29
757 763 1.635817 AACACCACAGGACTGCCACT 61.636 55.000 0.00 0.0 36.29 4.00
770 776 1.965930 GATCGCCACAGCAACACCA 60.966 57.895 0.00 0.0 39.83 4.17
1180 1191 6.951971 TGTTTTTCTTTCCCATTTCCTCAAA 58.048 32.000 0.00 0.0 0.00 2.69
1569 1581 5.071788 TGCTCGATAATTAGTGGAGGGAAAT 59.928 40.000 10.45 0.0 0.00 2.17
1686 1699 4.634012 AAGCTGTATTCCAGTTGTACCA 57.366 40.909 0.00 0.0 43.55 3.25
1741 1754 1.661341 GGCAAGAGTTCTGCATCGAT 58.339 50.000 0.00 0.0 0.00 3.59
1876 1889 2.599645 ATCTTCATGCCGCCGCTTCT 62.600 55.000 0.00 0.0 35.36 2.85
2009 2022 3.575256 TGAGGAGGTACGCAAAGAACTTA 59.425 43.478 0.00 0.0 0.00 2.24
2257 2270 6.210522 TCTCCTCTTTACCTATAAAAGCCCT 58.789 40.000 0.00 0.0 34.58 5.19


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.