Multiple sequence alignment - TraesCS2B01G513500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G513500 chr2B 100.000 1906 0 0 380 2285 708697255 708695350 0.000000e+00 3520
1 TraesCS2B01G513500 chr2B 100.000 183 0 0 1 183 708697634 708697452 2.810000e-89 339
2 TraesCS2B01G513500 chr2B 93.583 187 6 5 1 183 673834916 673835100 8.040000e-70 274
3 TraesCS2B01G513500 chr3A 99.050 1895 18 0 391 2285 514529329 514531223 0.000000e+00 3400
4 TraesCS2B01G513500 chr3A 98.741 1906 24 0 380 2285 627956570 627954665 0.000000e+00 3387
5 TraesCS2B01G513500 chr3A 100.000 183 0 0 1 183 514529168 514529350 2.810000e-89 339
6 TraesCS2B01G513500 chr3A 96.216 185 5 2 1 183 627956722 627956538 3.690000e-78 302
7 TraesCS2B01G513500 chr6B 98.741 1906 23 1 380 2285 439442594 439440690 0.000000e+00 3386
8 TraesCS2B01G513500 chr6B 93.514 185 10 2 1 183 439442746 439442562 8.040000e-70 274
9 TraesCS2B01G513500 chr6A 98.583 1906 27 0 380 2285 214162738 214160833 0.000000e+00 3371
10 TraesCS2B01G513500 chr6A 95.135 185 7 2 1 183 214162890 214162706 7.990000e-75 291
11 TraesCS2B01G513500 chr7A 98.531 1906 28 0 380 2285 613754897 613752992 0.000000e+00 3365
12 TraesCS2B01G513500 chr7A 92.973 185 11 2 1 183 613755049 613754865 3.740000e-68 268
13 TraesCS2B01G513500 chr5B 98.531 1906 28 0 380 2285 524582605 524580700 0.000000e+00 3365
14 TraesCS2B01G513500 chr5B 96.216 185 5 2 1 183 332626449 332626265 3.690000e-78 302
15 TraesCS2B01G513500 chr5B 95.676 185 6 2 1 183 255655908 255656092 1.720000e-76 296
16 TraesCS2B01G513500 chr7B 98.321 1906 30 1 380 2285 577195339 577193436 0.000000e+00 3341
17 TraesCS2B01G513500 chr7B 93.514 185 10 2 1 183 577195491 577195307 8.040000e-70 274
18 TraesCS2B01G513500 chr1A 98.269 1906 33 0 380 2285 64891007 64889102 0.000000e+00 3338
19 TraesCS2B01G513500 chr4B 97.167 1906 52 2 380 2285 519580071 519578168 0.000000e+00 3219


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G513500 chr2B 708695350 708697634 2284 True 1929.5 3520 100.0000 1 2285 2 chr2B.!!$R1 2284
1 TraesCS2B01G513500 chr3A 514529168 514531223 2055 False 1869.5 3400 99.5250 1 2285 2 chr3A.!!$F1 2284
2 TraesCS2B01G513500 chr3A 627954665 627956722 2057 True 1844.5 3387 97.4785 1 2285 2 chr3A.!!$R1 2284
3 TraesCS2B01G513500 chr6B 439440690 439442746 2056 True 1830.0 3386 96.1275 1 2285 2 chr6B.!!$R1 2284
4 TraesCS2B01G513500 chr6A 214160833 214162890 2057 True 1831.0 3371 96.8590 1 2285 2 chr6A.!!$R1 2284
5 TraesCS2B01G513500 chr7A 613752992 613755049 2057 True 1816.5 3365 95.7520 1 2285 2 chr7A.!!$R1 2284
6 TraesCS2B01G513500 chr5B 524580700 524582605 1905 True 3365.0 3365 98.5310 380 2285 1 chr5B.!!$R2 1905
7 TraesCS2B01G513500 chr7B 577193436 577195491 2055 True 1807.5 3341 95.9175 1 2285 2 chr7B.!!$R1 2284
8 TraesCS2B01G513500 chr1A 64889102 64891007 1905 True 3338.0 3338 98.2690 380 2285 1 chr1A.!!$R1 1905
9 TraesCS2B01G513500 chr4B 519578168 519580071 1903 True 3219.0 3219 97.1670 380 2285 1 chr4B.!!$R1 1905

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
642 644 0.041312 CAACACAAACCCGAAGCTCG 60.041 55.0 0.0 0.0 40.07 5.03 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2054 2056 1.342874 CCCCACCCAAAATGGCATCTA 60.343 52.381 0.0 0.0 35.79 1.98 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
161 163 1.002366 CTTAGGCGCTGCACTAACAG 58.998 55.000 7.64 0.00 40.80 3.16
162 164 0.320374 TTAGGCGCTGCACTAACAGT 59.680 50.000 7.64 0.00 39.96 3.55
170 172 2.863153 CACTAACAGTGCAGCGCC 59.137 61.111 2.29 0.00 39.62 6.53
171 173 1.669115 CACTAACAGTGCAGCGCCT 60.669 57.895 2.29 0.00 39.62 5.52
172 174 0.389817 CACTAACAGTGCAGCGCCTA 60.390 55.000 2.29 0.00 39.62 3.93
173 175 0.108615 ACTAACAGTGCAGCGCCTAG 60.109 55.000 2.29 4.23 0.00 3.02
642 644 0.041312 CAACACAAACCCGAAGCTCG 60.041 55.000 0.00 0.00 40.07 5.03
897 899 5.740290 TTCATAGTATGCTAGGGTTAGGC 57.260 43.478 5.18 0.00 30.61 3.93
1051 1053 2.548067 CCGTGTGCTAACCAAGAAGACT 60.548 50.000 0.00 0.00 0.00 3.24
1349 1351 4.202305 GCCTCCTCTATGCAAGTACTTCAT 60.202 45.833 18.35 18.35 0.00 2.57
1471 1473 0.522180 GGAAGAGCGTCGTCAGAAGA 59.478 55.000 0.00 0.00 0.00 2.87
1566 1568 0.312102 GAAAGCTTGCAAAGGCTCGT 59.688 50.000 13.02 5.32 46.35 4.18
1761 1763 9.194271 CATTTGTCATTTGTAATGAATGTGTCA 57.806 29.630 3.83 0.00 41.67 3.58
1863 1865 3.819902 TGTGATGCTGCAGTCATTGTAAA 59.180 39.130 16.64 3.40 0.00 2.01
2142 2144 2.681848 CTGGACATGCTAAGCAAAGAGG 59.318 50.000 0.00 0.00 43.62 3.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
161 163 2.747855 AAAGGCTAGGCGCTGCAC 60.748 61.111 7.64 4.42 39.13 4.57
162 164 2.747460 CAAAGGCTAGGCGCTGCA 60.747 61.111 7.64 0.00 39.13 4.41
163 165 3.512516 CCAAAGGCTAGGCGCTGC 61.513 66.667 7.64 9.76 39.13 5.25
164 166 2.825836 CCCAAAGGCTAGGCGCTG 60.826 66.667 7.64 11.66 39.13 5.18
897 899 5.830912 ACACCAACATCAAACACACATAAG 58.169 37.500 0.00 0.00 0.00 1.73
1051 1053 1.228124 CCTCCCACTTGTTCGGCAA 60.228 57.895 0.00 0.00 35.50 4.52
1349 1351 3.519107 TGGCACTTCAAGATCTATCCACA 59.481 43.478 0.00 0.00 0.00 4.17
1471 1473 1.573108 TTCTTCCGCTCCATCCTCTT 58.427 50.000 0.00 0.00 0.00 2.85
1566 1568 2.283894 TCCTCCTCTTGCGCCTCA 60.284 61.111 4.18 0.00 0.00 3.86
1761 1763 6.876789 TCAAACATTAGTACGACATGGTTCAT 59.123 34.615 0.00 0.00 0.00 2.57
1792 1794 5.113383 TGCCGACGATGTTCATAACTTAAT 58.887 37.500 0.00 0.00 0.00 1.40
1863 1865 6.384305 GGCTACTCCCACTACATCCATAATAT 59.616 42.308 0.00 0.00 0.00 1.28
2054 2056 1.342874 CCCCACCCAAAATGGCATCTA 60.343 52.381 0.00 0.00 35.79 1.98


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.