Multiple sequence alignment - TraesCS2B01G501700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G501700 chr2B 100.000 2601 0 0 1 2601 697143620 697141020 0.000000e+00 4804
1 TraesCS2B01G501700 chr2B 97.099 2206 42 6 1 2189 697342526 697340326 0.000000e+00 3699
2 TraesCS2B01G501700 chr2B 97.007 2205 43 7 1 2189 697380033 697377836 0.000000e+00 3685
3 TraesCS2B01G501700 chr2B 94.488 2050 91 5 1 2035 697399850 697397808 0.000000e+00 3140
4 TraesCS2B01G501700 chr2B 96.905 1874 39 3 334 2189 697295970 697294098 0.000000e+00 3121
5 TraesCS2B01G501700 chr2B 96.568 1690 38 3 515 2189 697158085 697156401 0.000000e+00 2782
6 TraesCS2B01G501700 chr2B 96.385 1549 36 3 416 1949 697015566 697014023 0.000000e+00 2532
7 TraesCS2B01G501700 chr2B 96.270 1528 36 4 515 2027 697229320 697227799 0.000000e+00 2486
8 TraesCS2B01G501700 chr2B 95.393 521 20 2 4 524 697186145 697185629 0.000000e+00 826
9 TraesCS2B01G501700 chr2B 95.048 525 21 3 1 524 697257873 697257353 0.000000e+00 821
10 TraesCS2B01G501700 chr2B 99.746 394 1 0 2208 2601 697156334 697155941 0.000000e+00 723
11 TraesCS2B01G501700 chr2B 97.543 407 9 1 2195 2601 697010552 697010147 0.000000e+00 695
12 TraesCS2B01G501700 chr2B 98.667 375 4 1 2227 2601 697358907 697358534 0.000000e+00 664
13 TraesCS2B01G501700 chr2B 98.667 375 4 1 2227 2601 697377772 697377399 0.000000e+00 664
14 TraesCS2B01G501700 chr2B 98.400 375 5 1 2227 2601 697340262 697339889 0.000000e+00 658
15 TraesCS2B01G501700 chr2B 96.496 371 12 1 2231 2601 697397685 697397316 1.710000e-171 612
16 TraesCS2B01G501700 chr2B 98.230 339 5 1 1 339 697324229 697323892 2.230000e-165 592
17 TraesCS2B01G501700 chr2B 99.060 319 3 0 2283 2601 697227251 697226933 8.070000e-160 573
18 TraesCS2B01G501700 chr2B 97.119 243 7 0 1947 2189 697010858 697010616 6.700000e-111 411
19 TraesCS2B01G501700 chr2B 98.942 189 2 0 2413 2601 697289903 697289715 3.210000e-89 339
20 TraesCS2B01G501700 chr2B 100.000 120 0 0 2070 2189 697359090 697358971 3.370000e-54 222
21 TraesCS2B01G501700 chr2B 96.694 121 4 0 2244 2364 697290022 697289902 4.390000e-48 202
22 TraesCS2B01G501700 chr2B 96.825 63 2 0 2127 2189 697397811 697397749 3.540000e-19 106
23 TraesCS2B01G501700 chr2D 88.478 1432 122 19 341 1742 579511873 579510455 0.000000e+00 1690
24 TraesCS2B01G501700 chr2D 91.553 367 28 3 2237 2601 579510105 579509740 1.070000e-138 503
25 TraesCS2B01G501700 chr2D 92.727 110 7 1 2026 2134 30406752 30406643 9.640000e-35 158
26 TraesCS2B01G501700 chr2A 78.895 706 144 5 930 1633 773563499 773562797 8.420000e-130 473
27 TraesCS2B01G501700 chr3B 95.238 105 4 1 2030 2133 548846840 548846944 5.760000e-37 165
28 TraesCS2B01G501700 chr3B 92.857 112 6 2 2034 2145 674424290 674424181 7.450000e-36 161


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G501700 chr2B 697141020 697143620 2600 True 4804.000000 4804 100.000000 1 2601 1 chr2B.!!$R1 2600
1 TraesCS2B01G501700 chr2B 697294098 697295970 1872 True 3121.000000 3121 96.905000 334 2189 1 chr2B.!!$R4 1855
2 TraesCS2B01G501700 chr2B 697339889 697342526 2637 True 2178.500000 3699 97.749500 1 2601 2 chr2B.!!$R10 2600
3 TraesCS2B01G501700 chr2B 697377399 697380033 2634 True 2174.500000 3685 97.837000 1 2601 2 chr2B.!!$R12 2600
4 TraesCS2B01G501700 chr2B 697155941 697158085 2144 True 1752.500000 2782 98.157000 515 2601 2 chr2B.!!$R7 2086
5 TraesCS2B01G501700 chr2B 697226933 697229320 2387 True 1529.500000 2486 97.665000 515 2601 2 chr2B.!!$R8 2086
6 TraesCS2B01G501700 chr2B 697397316 697399850 2534 True 1286.000000 3140 95.936333 1 2601 3 chr2B.!!$R13 2600
7 TraesCS2B01G501700 chr2B 697010147 697015566 5419 True 1212.666667 2532 97.015667 416 2601 3 chr2B.!!$R6 2185
8 TraesCS2B01G501700 chr2B 697185629 697186145 516 True 826.000000 826 95.393000 4 524 1 chr2B.!!$R2 520
9 TraesCS2B01G501700 chr2B 697257353 697257873 520 True 821.000000 821 95.048000 1 524 1 chr2B.!!$R3 523
10 TraesCS2B01G501700 chr2B 697358534 697359090 556 True 443.000000 664 99.333500 2070 2601 2 chr2B.!!$R11 531
11 TraesCS2B01G501700 chr2D 579509740 579511873 2133 True 1096.500000 1690 90.015500 341 2601 2 chr2D.!!$R2 2260
12 TraesCS2B01G501700 chr2A 773562797 773563499 702 True 473.000000 473 78.895000 930 1633 1 chr2A.!!$R1 703

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
260 262 2.002505 TTTCCGGATGCCTTTTTGGA 57.997 45.0 4.15 0.0 38.35 3.53 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1747 1790 5.368145 TGGGAGAAATATCATGAACCTTCG 58.632 41.667 0.0 0.0 0.0 3.79 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
218 220 6.012508 CCAACATCCCAGGTAATACTATCCAT 60.013 42.308 0.00 0.00 0.00 3.41
260 262 2.002505 TTTCCGGATGCCTTTTTGGA 57.997 45.000 4.15 0.00 38.35 3.53
843 872 2.343101 TGCCTATATTTCGGTATGCGC 58.657 47.619 0.00 0.00 0.00 6.09
891 920 8.291888 TGTTGTTTTAAATTCATGTTCGGATG 57.708 30.769 0.00 0.00 0.00 3.51
896 925 3.492421 AATTCATGTTCGGATGTGCAC 57.508 42.857 10.75 10.75 0.00 4.57
1267 1297 2.501723 ACACGACAGGAGCTAATGGATT 59.498 45.455 0.00 0.00 0.00 3.01
1747 1790 9.744468 ATTTGTTACCTTCATTGTAAAACTCAC 57.256 29.630 0.00 0.00 30.52 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
574 584 6.183360 GCTAATATGCTCTACCGCTAGAGAAT 60.183 42.308 17.24 14.58 46.56 2.40
843 872 6.811170 ACATTTTACTGCGAACATTAATTGGG 59.189 34.615 0.00 0.00 0.00 4.12
891 920 9.083080 GTTTATCCAAACATTAATTAGGTGCAC 57.917 33.333 8.80 8.80 43.02 4.57
1267 1297 7.232330 TGTCATTTATGTTCTTGATTGGTTCCA 59.768 33.333 0.00 0.00 0.00 3.53
1734 1776 6.485313 TCATGAACCTTCGTGAGTTTTACAAT 59.515 34.615 5.94 0.00 45.50 2.71
1747 1790 5.368145 TGGGAGAAATATCATGAACCTTCG 58.632 41.667 0.00 0.00 0.00 3.79


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.