Multiple sequence alignment - TraesCS2B01G487500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G487500 chr2B 100.000 3994 0 0 1 3994 683740942 683736949 0.000000e+00 7376
1 TraesCS2B01G487500 chr7B 97.781 4011 56 11 1 3994 662742527 662746521 0.000000e+00 6883
2 TraesCS2B01G487500 chr1D 96.801 4001 65 12 1 3994 254471901 254467957 0.000000e+00 6621
3 TraesCS2B01G487500 chr1D 95.608 4007 106 26 1 3994 180373764 180377713 0.000000e+00 6360
4 TraesCS2B01G487500 chr5D 96.682 4009 60 22 1 3994 503325994 503322044 0.000000e+00 6599
5 TraesCS2B01G487500 chr5D 96.665 3598 67 19 1 3589 6240801 6244354 0.000000e+00 5930
6 TraesCS2B01G487500 chr7A 96.401 3029 80 12 119 3146 537845675 537842675 0.000000e+00 4963
7 TraesCS2B01G487500 chr7A 96.811 2383 47 7 1 2382 12217387 12219741 0.000000e+00 3952
8 TraesCS2B01G487500 chr7A 94.148 2358 118 11 1 2355 352301820 352304160 0.000000e+00 3572
9 TraesCS2B01G487500 chr7A 93.139 1647 77 16 2348 3994 352351140 352352750 0.000000e+00 2383
10 TraesCS2B01G487500 chrUn 98.010 2764 42 5 1242 3994 298932655 298935416 0.000000e+00 4787
11 TraesCS2B01G487500 chrUn 96.419 1564 16 6 2433 3994 357608517 357610042 0.000000e+00 2542
12 TraesCS2B01G487500 chrUn 96.237 1063 11 8 2946 3994 359776170 359775123 0.000000e+00 1714
13 TraesCS2B01G487500 chrUn 98.678 605 7 1 3162 3766 472494954 472495557 0.000000e+00 1072
14 TraesCS2B01G487500 chr3B 98.010 2764 42 4 1242 3994 201483719 201480958 0.000000e+00 4787
15 TraesCS2B01G487500 chr3A 97.406 2506 48 7 1 2504 524023677 524021187 0.000000e+00 4252
16 TraesCS2B01G487500 chr3A 99.563 229 1 0 1 229 273160327 273160555 6.170000e-113 418
17 TraesCS2B01G487500 chr2A 96.305 2517 67 12 589 3102 359079330 359076837 0.000000e+00 4109
18 TraesCS2B01G487500 chr2A 92.705 562 16 4 2953 3511 65683450 65683989 0.000000e+00 787
19 TraesCS2B01G487500 chr2A 99.051 316 3 0 3009 3324 202409183 202409498 5.790000e-158 568
20 TraesCS2B01G487500 chr2A 94.470 217 11 1 2702 2917 601728985 601729201 2.300000e-87 333
21 TraesCS2B01G487500 chr3D 97.618 2183 29 7 1430 3609 24158199 24156037 0.000000e+00 3722
22 TraesCS2B01G487500 chr3D 94.565 828 11 7 3167 3994 545159863 545160656 0.000000e+00 1249
23 TraesCS2B01G487500 chr1A 97.721 1009 7 2 2986 3994 554491570 554490578 0.000000e+00 1722


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G487500 chr2B 683736949 683740942 3993 True 7376 7376 100.000 1 3994 1 chr2B.!!$R1 3993
1 TraesCS2B01G487500 chr7B 662742527 662746521 3994 False 6883 6883 97.781 1 3994 1 chr7B.!!$F1 3993
2 TraesCS2B01G487500 chr1D 254467957 254471901 3944 True 6621 6621 96.801 1 3994 1 chr1D.!!$R1 3993
3 TraesCS2B01G487500 chr1D 180373764 180377713 3949 False 6360 6360 95.608 1 3994 1 chr1D.!!$F1 3993
4 TraesCS2B01G487500 chr5D 503322044 503325994 3950 True 6599 6599 96.682 1 3994 1 chr5D.!!$R1 3993
5 TraesCS2B01G487500 chr5D 6240801 6244354 3553 False 5930 5930 96.665 1 3589 1 chr5D.!!$F1 3588
6 TraesCS2B01G487500 chr7A 537842675 537845675 3000 True 4963 4963 96.401 119 3146 1 chr7A.!!$R1 3027
7 TraesCS2B01G487500 chr7A 12217387 12219741 2354 False 3952 3952 96.811 1 2382 1 chr7A.!!$F1 2381
8 TraesCS2B01G487500 chr7A 352301820 352304160 2340 False 3572 3572 94.148 1 2355 1 chr7A.!!$F2 2354
9 TraesCS2B01G487500 chr7A 352351140 352352750 1610 False 2383 2383 93.139 2348 3994 1 chr7A.!!$F3 1646
10 TraesCS2B01G487500 chrUn 298932655 298935416 2761 False 4787 4787 98.010 1242 3994 1 chrUn.!!$F1 2752
11 TraesCS2B01G487500 chrUn 357608517 357610042 1525 False 2542 2542 96.419 2433 3994 1 chrUn.!!$F2 1561
12 TraesCS2B01G487500 chrUn 359775123 359776170 1047 True 1714 1714 96.237 2946 3994 1 chrUn.!!$R1 1048
13 TraesCS2B01G487500 chrUn 472494954 472495557 603 False 1072 1072 98.678 3162 3766 1 chrUn.!!$F3 604
14 TraesCS2B01G487500 chr3B 201480958 201483719 2761 True 4787 4787 98.010 1242 3994 1 chr3B.!!$R1 2752
15 TraesCS2B01G487500 chr3A 524021187 524023677 2490 True 4252 4252 97.406 1 2504 1 chr3A.!!$R1 2503
16 TraesCS2B01G487500 chr2A 359076837 359079330 2493 True 4109 4109 96.305 589 3102 1 chr2A.!!$R1 2513
17 TraesCS2B01G487500 chr2A 65683450 65683989 539 False 787 787 92.705 2953 3511 1 chr2A.!!$F1 558
18 TraesCS2B01G487500 chr3D 24156037 24158199 2162 True 3722 3722 97.618 1430 3609 1 chr3D.!!$R1 2179
19 TraesCS2B01G487500 chr3D 545159863 545160656 793 False 1249 1249 94.565 3167 3994 1 chr3D.!!$F1 827
20 TraesCS2B01G487500 chr1A 554490578 554491570 992 True 1722 1722 97.721 2986 3994 1 chr1A.!!$R1 1008

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
34 35 2.650827 TCCCCTTTCCCCGAACTAAATT 59.349 45.455 0.00 0.0 0.0 1.82 F
1308 1336 3.266510 TGATGCGGCTTCAGATACTTT 57.733 42.857 13.84 0.0 0.0 2.66 F
1738 1766 1.681264 GCCCCTTTCGGTTCATAATGG 59.319 52.381 0.00 0.0 0.0 3.16 F
1752 1780 5.640158 TCATAATGGGACGGGACTAATTT 57.360 39.130 0.00 0.0 0.0 1.82 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1738 1766 7.284716 AGGATCAAAATAAAATTAGTCCCGTCC 59.715 37.037 0.0 0.0 0.00 4.79 R
2310 2357 5.007385 TCTTTACGGTGCTTTCTCTATCC 57.993 43.478 0.0 0.0 0.00 2.59 R
2690 2744 5.221422 CCAATTTGTTCTTGGGTCTAAGCAA 60.221 40.000 0.0 0.0 39.62 3.91 R
3703 3871 7.123547 TCCACAACAATTTTTACTTCTGGTTCT 59.876 33.333 0.0 0.0 0.00 3.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
34 35 2.650827 TCCCCTTTCCCCGAACTAAATT 59.349 45.455 0.00 0.00 0.00 1.82
294 297 9.509956 TGAATTAATAAAAACGGAAAGAGAGGA 57.490 29.630 0.00 0.00 0.00 3.71
510 519 9.170890 TGATATAAGTGGAAGGATACAGGATTT 57.829 33.333 0.00 0.00 41.41 2.17
655 665 8.725405 TTAGAATTCCGTTTGCATAAGATACA 57.275 30.769 0.65 0.00 0.00 2.29
1308 1336 3.266510 TGATGCGGCTTCAGATACTTT 57.733 42.857 13.84 0.00 0.00 2.66
1438 1466 7.822822 GGAGAAAAGCACTACACCTAGAAATAA 59.177 37.037 0.00 0.00 0.00 1.40
1738 1766 1.681264 GCCCCTTTCGGTTCATAATGG 59.319 52.381 0.00 0.00 0.00 3.16
1752 1780 5.640158 TCATAATGGGACGGGACTAATTT 57.360 39.130 0.00 0.00 0.00 1.82
1762 1790 7.067737 TGGGACGGGACTAATTTTATTTTGATC 59.932 37.037 0.00 0.00 0.00 2.92
2195 2241 6.841781 AAAAGGGCTTTCTACATAGGGATA 57.158 37.500 0.00 0.00 31.45 2.59
3088 3145 9.151752 CGTAAGATCGAATCAAGAATTTCATTG 57.848 33.333 0.00 1.53 43.02 2.82
3190 3253 9.470399 GTAATAAAGTGAATAAAAAGAGGGGGA 57.530 33.333 0.00 0.00 0.00 4.81
3703 3871 5.235616 GGACTTAATGATTATTCGTTCGCCA 59.764 40.000 0.00 0.00 33.19 5.69
3956 4124 4.359434 TGGTTGAGTGGCATGTACTTTA 57.641 40.909 6.28 0.00 0.00 1.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
34 35 5.718801 TTAATGGTAATGGTCTTAGGGCA 57.281 39.130 0.00 0.00 0.00 5.36
510 519 4.153475 AGCGAGCGCAATTTCTAGTAAAAA 59.847 37.500 17.68 0.00 44.88 1.94
564 574 9.097257 CTTCCATTTTCTTTTTCTTTAGTTGCA 57.903 29.630 0.00 0.00 0.00 4.08
746 761 8.704849 TTCATTCCACTTTCCTATTTCTGAAA 57.295 30.769 5.15 5.15 0.00 2.69
1308 1336 9.594478 TTCGCTCAATACTCAAATCTACAATTA 57.406 29.630 0.00 0.00 0.00 1.40
1738 1766 7.284716 AGGATCAAAATAAAATTAGTCCCGTCC 59.715 37.037 0.00 0.00 0.00 4.79
2195 2241 8.852135 TGATAGGGAAAAATCGTTGTTTTTACT 58.148 29.630 13.75 13.01 40.27 2.24
2308 2355 5.128827 TCTTTACGGTGCTTTCTCTATCCAT 59.871 40.000 0.00 0.00 0.00 3.41
2310 2357 5.007385 TCTTTACGGTGCTTTCTCTATCC 57.993 43.478 0.00 0.00 0.00 2.59
2690 2744 5.221422 CCAATTTGTTCTTGGGTCTAAGCAA 60.221 40.000 0.00 0.00 39.62 3.91
2732 2786 9.408648 GAATTTCCCCTATCTTAACTGAATTCA 57.591 33.333 8.12 8.12 0.00 2.57
3703 3871 7.123547 TCCACAACAATTTTTACTTCTGGTTCT 59.876 33.333 0.00 0.00 0.00 3.01
3956 4124 1.749334 TTGGAAAAACGGGCGCCATT 61.749 50.000 30.85 19.41 0.00 3.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.