Multiple sequence alignment - TraesCS2B01G478200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G478200 chr2B 100.000 3656 0 0 1 3656 675366840 675363185 0 6752
1 TraesCS2B01G478200 chr2B 90.904 3661 324 6 4 3656 262528545 262524886 0 4907
2 TraesCS2B01G478200 chr2B 90.887 3665 323 8 1 3656 704813870 704817532 0 4907
3 TraesCS2B01G478200 chr2B 83.934 3660 508 52 62 3656 577245403 577249047 0 3428
4 TraesCS2B01G478200 chr2B 89.669 1694 157 7 35 1720 412057526 412055843 0 2143
5 TraesCS2B01G478200 chr3B 98.578 3657 51 1 1 3656 605004272 605007928 0 6464
6 TraesCS2B01G478200 chr3B 91.390 2834 220 10 694 3506 162623912 162626742 0 3860
7 TraesCS2B01G478200 chr5B 91.767 3656 265 18 5 3654 437771099 437767474 0 5051
8 TraesCS2B01G478200 chr1A 98.505 2676 39 1 981 3656 25581849 25579175 0 4719
9 TraesCS2B01G478200 chr3A 92.716 3199 212 9 458 3654 332221537 332224716 0 4597
10 TraesCS2B01G478200 chr7B 85.915 3699 463 32 10 3656 368143661 368139969 0 3892
11 TraesCS2B01G478200 chr7B 81.869 1252 217 7 204 1452 697174010 697172766 0 1046
12 TraesCS2B01G478200 chr2A 92.847 1426 100 2 2230 3654 140209325 140210749 0 2067


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G478200 chr2B 675363185 675366840 3655 True 6752 6752 100.000 1 3656 1 chr2B.!!$R3 3655
1 TraesCS2B01G478200 chr2B 262524886 262528545 3659 True 4907 4907 90.904 4 3656 1 chr2B.!!$R1 3652
2 TraesCS2B01G478200 chr2B 704813870 704817532 3662 False 4907 4907 90.887 1 3656 1 chr2B.!!$F2 3655
3 TraesCS2B01G478200 chr2B 577245403 577249047 3644 False 3428 3428 83.934 62 3656 1 chr2B.!!$F1 3594
4 TraesCS2B01G478200 chr2B 412055843 412057526 1683 True 2143 2143 89.669 35 1720 1 chr2B.!!$R2 1685
5 TraesCS2B01G478200 chr3B 605004272 605007928 3656 False 6464 6464 98.578 1 3656 1 chr3B.!!$F2 3655
6 TraesCS2B01G478200 chr3B 162623912 162626742 2830 False 3860 3860 91.390 694 3506 1 chr3B.!!$F1 2812
7 TraesCS2B01G478200 chr5B 437767474 437771099 3625 True 5051 5051 91.767 5 3654 1 chr5B.!!$R1 3649
8 TraesCS2B01G478200 chr1A 25579175 25581849 2674 True 4719 4719 98.505 981 3656 1 chr1A.!!$R1 2675
9 TraesCS2B01G478200 chr3A 332221537 332224716 3179 False 4597 4597 92.716 458 3654 1 chr3A.!!$F1 3196
10 TraesCS2B01G478200 chr7B 368139969 368143661 3692 True 3892 3892 85.915 10 3656 1 chr7B.!!$R1 3646
11 TraesCS2B01G478200 chr7B 697172766 697174010 1244 True 1046 1046 81.869 204 1452 1 chr7B.!!$R2 1248
12 TraesCS2B01G478200 chr2A 140209325 140210749 1424 False 2067 2067 92.847 2230 3654 1 chr2A.!!$F1 1424

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
33 34 1.829222 CCTCTAGGTTCCGGTGCTTTA 59.171 52.381 0.00 0.00 0.00 1.85 F
493 506 2.279073 CTCGGAGCCCCAGGTCTA 59.721 66.667 0.00 0.00 40.49 2.59 F
1705 1741 0.742990 CACAGAAAATCCGGCCGCTA 60.743 55.000 22.85 10.78 0.00 4.26 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1501 1519 1.548719 CCAGTCTGACGGACCAATACA 59.451 52.381 10.92 0.0 45.54 2.29 R
1571 1589 1.736645 GTGGTGACCACGGTGATCG 60.737 63.158 20.19 0.0 44.95 3.69 R
3274 3350 2.047560 GGTAAGCGTGGGCGTCTT 60.048 61.111 0.00 0.0 46.35 3.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
33 34 1.829222 CCTCTAGGTTCCGGTGCTTTA 59.171 52.381 0.00 0.00 0.00 1.85
387 396 4.654262 TGGTCTCTACTTCAGTTGTTTCCT 59.346 41.667 0.00 0.00 0.00 3.36
493 506 2.279073 CTCGGAGCCCCAGGTCTA 59.721 66.667 0.00 0.00 40.49 2.59
1705 1741 0.742990 CACAGAAAATCCGGCCGCTA 60.743 55.000 22.85 10.78 0.00 4.26
2304 2379 5.236263 GCTGGGTAACATCAAAACTTTTTGG 59.764 40.000 13.21 2.77 42.85 3.28
2794 2870 2.225727 GGATTTGTTGACTCGGTGAACC 59.774 50.000 4.51 0.00 29.02 3.62
2815 2891 4.512571 ACCCGGCGATTGTATGTATTTTAC 59.487 41.667 9.30 0.00 0.00 2.01
3274 3350 1.955778 TCACGTGGAGTAACGAAAGGA 59.044 47.619 17.00 0.00 46.49 3.36
3369 3445 2.358737 CAAGCCCTGTCCACGGAC 60.359 66.667 9.38 9.38 44.77 4.79
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
33 34 2.603776 AGAACGAGAAGCGGGGGT 60.604 61.111 0.00 0.00 46.49 4.95
372 381 3.954258 CCCTTCAAGGAAACAACTGAAGT 59.046 43.478 4.43 0.00 39.89 3.01
897 910 3.034030 GCCTTGTTGCGCAACTCT 58.966 55.556 42.62 0.00 41.67 3.24
928 941 0.460987 AAGTAGCCATGCTCGACTGC 60.461 55.000 0.00 0.00 40.44 4.40
1501 1519 1.548719 CCAGTCTGACGGACCAATACA 59.451 52.381 10.92 0.00 45.54 2.29
1571 1589 1.736645 GTGGTGACCACGGTGATCG 60.737 63.158 20.19 0.00 44.95 3.69
1705 1741 2.671070 CGCCCTGTCCCTGACAAT 59.329 61.111 0.00 0.00 42.26 2.71
1987 2047 2.299326 AGCTGCAAATCCACTTCCTT 57.701 45.000 1.02 0.00 0.00 3.36
2304 2379 4.722700 TTCTTCAGCAGCCCGGCC 62.723 66.667 5.55 0.00 0.00 6.13
2794 2870 5.660629 TGTAAAATACATACAATCGCCGG 57.339 39.130 0.00 0.00 32.89 6.13
2815 2891 4.537135 TCACTACCTCTAGCTTGGTTTG 57.463 45.455 10.32 8.72 37.74 2.93
3274 3350 2.047560 GGTAAGCGTGGGCGTCTT 60.048 61.111 0.00 0.00 46.35 3.01
3369 3445 3.366679 GCAATGGGCAATGATCGGAATAG 60.367 47.826 0.00 0.00 43.97 1.73


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.