Multiple sequence alignment - TraesCS2B01G461200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G461200 chr2B 100.000 2333 0 0 1 2333 654704642 654706974 0.000000e+00 4309.0
1 TraesCS2B01G461200 chr2B 98.457 2333 33 1 1 2333 654654539 654656868 0.000000e+00 4106.0
2 TraesCS2B01G461200 chr2B 98.286 2334 36 2 1 2333 654682810 654685140 0.000000e+00 4085.0
3 TraesCS2B01G461200 chr2B 97.692 2340 46 4 1 2333 654733561 654735899 0.000000e+00 4015.0
4 TraesCS2B01G461200 chr2B 89.783 323 26 4 1396 1713 662579017 662579337 7.760000e-110 407.0
5 TraesCS2B01G461200 chrUn 98.372 2334 34 2 1 2333 248127973 248130303 0.000000e+00 4096.0
6 TraesCS2B01G461200 chrUn 91.786 280 20 2 6 282 23776876 23776597 1.010000e-103 387.0
7 TraesCS2B01G461200 chrUn 91.786 280 20 2 6 282 371113027 371112748 1.010000e-103 387.0
8 TraesCS2B01G461200 chrUn 91.697 277 21 1 8 282 23774780 23774504 1.310000e-102 383.0
9 TraesCS2B01G461200 chr3D 91.864 762 58 4 951 1709 308763771 308764531 0.000000e+00 1061.0
10 TraesCS2B01G461200 chr3D 91.111 630 45 9 745 1368 462838794 462838170 0.000000e+00 843.0
11 TraesCS2B01G461200 chr3D 89.203 389 39 2 475 860 308762882 308763270 1.250000e-132 483.0
12 TraesCS2B01G461200 chr1A 90.199 653 62 2 470 1122 551827485 551828135 0.000000e+00 850.0
13 TraesCS2B01G461200 chr1A 90.323 465 38 4 1246 1709 551828427 551828885 9.220000e-169 603.0
14 TraesCS2B01G461200 chr3B 91.057 615 45 6 745 1354 615632602 615631993 0.000000e+00 822.0
15 TraesCS2B01G461200 chr3A 91.000 600 46 7 745 1341 605981455 605980861 0.000000e+00 802.0
16 TraesCS2B01G461200 chr2A 91.358 567 44 3 1711 2273 691115588 691115023 0.000000e+00 771.0
17 TraesCS2B01G461200 chr2D 89.929 566 36 6 1711 2273 547952386 547952933 0.000000e+00 710.0
18 TraesCS2B01G461200 chr2D 88.889 567 41 12 1712 2273 547806949 547807498 0.000000e+00 678.0
19 TraesCS2B01G461200 chr2D 94.138 290 16 1 475 763 2489682 2489393 7.650000e-120 440.0
20 TraesCS2B01G461200 chr2D 93.082 159 7 4 323 478 547806804 547806961 1.800000e-56 230.0
21 TraesCS2B01G461200 chr2D 89.444 180 10 7 304 478 547952224 547952399 3.900000e-53 219.0
22 TraesCS2B01G461200 chr2D 96.774 62 2 0 2272 2333 547807523 547807584 1.140000e-18 104.0
23 TraesCS2B01G461200 chr2D 90.323 62 6 0 2272 2333 547952958 547953019 5.340000e-12 82.4
24 TraesCS2B01G461200 chr1D 94.483 290 16 0 474 763 313666955 313666666 4.570000e-122 448.0
25 TraesCS2B01G461200 chr7D 94.118 289 17 0 475 763 249428469 249428757 7.650000e-120 440.0
26 TraesCS2B01G461200 chr7D 83.521 267 38 5 1874 2137 53277370 53277107 6.440000e-61 244.0
27 TraesCS2B01G461200 chr4A 90.343 321 27 4 1396 1713 97526993 97527312 3.590000e-113 418.0
28 TraesCS2B01G461200 chr1B 89.937 318 29 3 1394 1709 636306434 636306750 7.760000e-110 407.0
29 TraesCS2B01G461200 chr4B 92.143 280 19 2 6 282 628974828 628974549 2.170000e-105 392.0
30 TraesCS2B01G461200 chr4B 91.209 273 21 3 13 282 649247963 649248235 3.660000e-98 368.0
31 TraesCS2B01G461200 chr5B 85.115 262 37 2 1874 2134 527760621 527760361 1.370000e-67 267.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G461200 chr2B 654704642 654706974 2332 False 4309.000000 4309 100.000000 1 2333 1 chr2B.!!$F3 2332
1 TraesCS2B01G461200 chr2B 654654539 654656868 2329 False 4106.000000 4106 98.457000 1 2333 1 chr2B.!!$F1 2332
2 TraesCS2B01G461200 chr2B 654682810 654685140 2330 False 4085.000000 4085 98.286000 1 2333 1 chr2B.!!$F2 2332
3 TraesCS2B01G461200 chr2B 654733561 654735899 2338 False 4015.000000 4015 97.692000 1 2333 1 chr2B.!!$F4 2332
4 TraesCS2B01G461200 chrUn 248127973 248130303 2330 False 4096.000000 4096 98.372000 1 2333 1 chrUn.!!$F1 2332
5 TraesCS2B01G461200 chrUn 23774504 23776876 2372 True 385.000000 387 91.741500 6 282 2 chrUn.!!$R2 276
6 TraesCS2B01G461200 chr3D 462838170 462838794 624 True 843.000000 843 91.111000 745 1368 1 chr3D.!!$R1 623
7 TraesCS2B01G461200 chr3D 308762882 308764531 1649 False 772.000000 1061 90.533500 475 1709 2 chr3D.!!$F1 1234
8 TraesCS2B01G461200 chr1A 551827485 551828885 1400 False 726.500000 850 90.261000 470 1709 2 chr1A.!!$F1 1239
9 TraesCS2B01G461200 chr3B 615631993 615632602 609 True 822.000000 822 91.057000 745 1354 1 chr3B.!!$R1 609
10 TraesCS2B01G461200 chr3A 605980861 605981455 594 True 802.000000 802 91.000000 745 1341 1 chr3A.!!$R1 596
11 TraesCS2B01G461200 chr2A 691115023 691115588 565 True 771.000000 771 91.358000 1711 2273 1 chr2A.!!$R1 562
12 TraesCS2B01G461200 chr2D 547806804 547807584 780 False 337.333333 678 92.915000 323 2333 3 chr2D.!!$F1 2010
13 TraesCS2B01G461200 chr2D 547952224 547953019 795 False 337.133333 710 89.898667 304 2333 3 chr2D.!!$F2 2029

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
664 750 1.593787 CCGTCAGAGCTGATGTGGT 59.406 57.895 16.17 0.0 43.28 4.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1877 3807 3.934579 GCGGAGTAAATAAAAACGGAGGA 59.065 43.478 0.0 0.0 0.0 3.71 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
269 276 3.327404 GCGTGGGGAAGGAGGGAA 61.327 66.667 0.00 0.00 0.00 3.97
664 750 1.593787 CCGTCAGAGCTGATGTGGT 59.406 57.895 16.17 0.00 43.28 4.16
743 829 3.370846 CCCACCTGTCAGCATCAATCTTA 60.371 47.826 0.00 0.00 0.00 2.10
950 1461 3.391382 GGTCTCCCTCCACCACGG 61.391 72.222 0.00 0.00 32.33 4.94
951 1462 4.083862 GTCTCCCTCCACCACGGC 62.084 72.222 0.00 0.00 33.14 5.68
1041 2791 1.553690 ATGAGGGCCGCAGTAACTGT 61.554 55.000 16.83 0.00 33.43 3.55
1202 2959 4.028490 CAACAGCCCGGCCACCTA 62.028 66.667 5.55 0.00 0.00 3.08
1877 3807 3.513515 GCCTATGCCTCTCTGCTATACTT 59.486 47.826 0.00 0.00 0.00 2.24
2108 4038 9.774742 GTTTGACTTAAGACAAAGCTAATATGG 57.225 33.333 26.21 0.00 39.51 2.74
2109 4039 9.733556 TTTGACTTAAGACAAAGCTAATATGGA 57.266 29.630 23.25 3.41 35.47 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
255 262 0.845102 GGTTCTTCCCTCCTTCCCCA 60.845 60.000 0.00 0.00 0.00 4.96
269 276 3.460712 GACTAGAGAGGACCTAGGGTTCT 59.539 52.174 14.81 12.34 45.69 3.01
664 750 6.418057 AAATAAATGGAGTTGACTTTGCCA 57.582 33.333 0.00 0.00 0.00 4.92
743 829 2.090775 GGGAGAGAGGAGGAGGAAGAAT 60.091 54.545 0.00 0.00 0.00 2.40
1180 2937 4.692475 GGCCGGGCTGTTGTACGT 62.692 66.667 22.87 0.00 0.00 3.57
1202 2959 1.988406 GAGTACTTGGAGGGGCGGT 60.988 63.158 0.00 0.00 0.00 5.68
1877 3807 3.934579 GCGGAGTAAATAAAAACGGAGGA 59.065 43.478 0.00 0.00 0.00 3.71


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.