Multiple sequence alignment - TraesCS2B01G461100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G461100 chr2B 100.000 2318 0 0 1 2318 654704313 654701996 0.000000e+00 4281
1 TraesCS2B01G461100 chr2B 98.965 2318 24 0 1 2318 654654210 654651893 0.000000e+00 4148
2 TraesCS2B01G461100 chr2B 98.965 2319 23 1 1 2318 654682481 654680163 0.000000e+00 4148
3 TraesCS2B01G461100 chr2B 98.558 1179 14 2 1141 2318 654730650 654729474 0.000000e+00 2080
4 TraesCS2B01G461100 chr2B 97.917 1152 23 1 1 1151 654733232 654732081 0.000000e+00 1993
5 TraesCS2B01G461100 chr2B 95.370 648 27 3 1 647 773823639 773824284 0.000000e+00 1027
6 TraesCS2B01G461100 chr2B 95.100 653 27 5 1 650 53243267 53242617 0.000000e+00 1024
7 TraesCS2B01G461100 chr2B 84.976 1025 112 20 695 1691 654649540 654648530 0.000000e+00 1002
8 TraesCS2B01G461100 chr2B 81.659 229 29 9 2095 2318 654587108 654586888 6.580000e-41 178
9 TraesCS2B01G461100 chrUn 99.008 2318 23 0 1 2318 248127644 248125327 0.000000e+00 4154
10 TraesCS2B01G461100 chrUn 95.538 650 26 3 1 649 23778589 23779236 0.000000e+00 1037
11 TraesCS2B01G461100 chrUn 85.171 1025 110 20 695 1691 248122975 248121965 0.000000e+00 1013
12 TraesCS2B01G461100 chr2D 94.044 1679 88 9 649 2316 547806785 547805108 0.000000e+00 2536
13 TraesCS2B01G461100 chr2D 92.509 1682 106 10 649 2316 547952222 547950547 0.000000e+00 2390
14 TraesCS2B01G461100 chr2D 85.032 1403 172 25 695 2075 547791561 547790175 0.000000e+00 1393
15 TraesCS2B01G461100 chr2D 81.452 744 98 22 1360 2075 547899933 547899202 7.180000e-160 573
16 TraesCS2B01G461100 chr2D 82.949 217 22 9 2098 2309 547790040 547789834 5.090000e-42 182
17 TraesCS2B01G461100 chr2A 89.183 1701 137 30 642 2318 691115747 691117424 0.000000e+00 2078
18 TraesCS2B01G461100 chr2A 87.539 971 85 20 1367 2318 691134199 691135152 0.000000e+00 1090
19 TraesCS2B01G461100 chr3D 95.107 654 30 2 1 653 19890190 19889538 0.000000e+00 1029
20 TraesCS2B01G461100 chr1B 95.231 650 28 3 1 649 612430701 612431348 0.000000e+00 1026


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G461100 chr2B 654701996 654704313 2317 True 4281.0 4281 100.0000 1 2318 1 chr2B.!!$R4 2317
1 TraesCS2B01G461100 chr2B 654680163 654682481 2318 True 4148.0 4148 98.9650 1 2318 1 chr2B.!!$R3 2317
2 TraesCS2B01G461100 chr2B 654648530 654654210 5680 True 2575.0 4148 91.9705 1 2318 2 chr2B.!!$R5 2317
3 TraesCS2B01G461100 chr2B 654729474 654733232 3758 True 2036.5 2080 98.2375 1 2318 2 chr2B.!!$R6 2317
4 TraesCS2B01G461100 chr2B 773823639 773824284 645 False 1027.0 1027 95.3700 1 647 1 chr2B.!!$F1 646
5 TraesCS2B01G461100 chr2B 53242617 53243267 650 True 1024.0 1024 95.1000 1 650 1 chr2B.!!$R1 649
6 TraesCS2B01G461100 chrUn 248121965 248127644 5679 True 2583.5 4154 92.0895 1 2318 2 chrUn.!!$R1 2317
7 TraesCS2B01G461100 chrUn 23778589 23779236 647 False 1037.0 1037 95.5380 1 649 1 chrUn.!!$F1 648
8 TraesCS2B01G461100 chr2D 547805108 547806785 1677 True 2536.0 2536 94.0440 649 2316 1 chr2D.!!$R1 1667
9 TraesCS2B01G461100 chr2D 547950547 547952222 1675 True 2390.0 2390 92.5090 649 2316 1 chr2D.!!$R3 1667
10 TraesCS2B01G461100 chr2D 547789834 547791561 1727 True 787.5 1393 83.9905 695 2309 2 chr2D.!!$R4 1614
11 TraesCS2B01G461100 chr2D 547899202 547899933 731 True 573.0 573 81.4520 1360 2075 1 chr2D.!!$R2 715
12 TraesCS2B01G461100 chr2A 691115747 691117424 1677 False 2078.0 2078 89.1830 642 2318 1 chr2A.!!$F1 1676
13 TraesCS2B01G461100 chr2A 691134199 691135152 953 False 1090.0 1090 87.5390 1367 2318 1 chr2A.!!$F2 951
14 TraesCS2B01G461100 chr3D 19889538 19890190 652 True 1029.0 1029 95.1070 1 653 1 chr3D.!!$R1 652
15 TraesCS2B01G461100 chr1B 612430701 612431348 647 False 1026.0 1026 95.2310 1 649 1 chr1B.!!$F1 648

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
396 401 1.874019 GCAGCGTCGTCATCATCGT 60.874 57.895 0.0 0.0 0.0 3.73 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2171 3812 4.019411 ACATTGTGTGATCCACCAGACATA 60.019 41.667 10.6 0.0 43.85 2.29 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
129 130 3.798511 CCCGGCTCCCCTTCTTCC 61.799 72.222 0.00 0.0 0.0 3.46
396 401 1.874019 GCAGCGTCGTCATCATCGT 60.874 57.895 0.00 0.0 0.0 3.73
443 448 4.117661 GGCGCTTCGGAGTCTCGT 62.118 66.667 7.64 0.0 0.0 4.18
937 947 5.916318 TCTCACACATTTCCAAAGCAAAAT 58.084 33.333 0.00 0.0 0.0 1.82
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
129 130 0.524816 GCGAAGATGGCATGCACAAG 60.525 55.000 21.36 4.77 0.00 3.16
396 401 1.142870 CAACACCTCCAAGAAGGGACA 59.857 52.381 0.00 0.00 41.04 4.02
443 448 1.120530 GAAGATCGTCCCCCAAGCTA 58.879 55.000 0.00 0.00 0.00 3.32
585 591 7.309177 CAAACATCCAATACAACCAACGATAA 58.691 34.615 0.00 0.00 0.00 1.75
937 947 5.772004 AGAGGAGATTTGGTCTTAGCTAGA 58.228 41.667 0.00 0.00 37.29 2.43
2169 3810 5.948742 TTGTGTGATCCACCAGACATATA 57.051 39.130 10.60 0.00 43.85 0.86
2171 3812 4.019411 ACATTGTGTGATCCACCAGACATA 60.019 41.667 10.60 0.00 43.85 2.29


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.