Multiple sequence alignment - TraesCS2B01G461000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G461000 chr2B 100.000 2276 0 0 1 2276 654700314 654698039 0.000000e+00 4204.0
1 TraesCS2B01G461000 chr2B 98.257 2295 20 6 2 2276 654650209 654647915 0.000000e+00 3999.0
2 TraesCS2B01G461000 chr2B 98.039 2295 25 6 2 2276 654727791 654725497 0.000000e+00 3971.0
3 TraesCS2B01G461000 chr2B 87.548 1052 92 19 638 1662 654546523 654545484 0.000000e+00 1181.0
4 TraesCS2B01G461000 chr2B 83.249 394 53 11 1743 2130 654652522 654652136 1.290000e-92 350.0
5 TraesCS2B01G461000 chr2B 95.699 93 3 1 1662 1753 760948660 760948752 5.070000e-32 148.0
6 TraesCS2B01G461000 chrUn 98.257 2295 19 7 2 2276 248123644 248121351 0.000000e+00 3997.0
7 TraesCS2B01G461000 chrUn 98.965 1546 15 1 732 2276 281905476 281907021 0.000000e+00 2765.0
8 TraesCS2B01G461000 chrUn 97.090 859 6 4 2 841 346479534 346480392 0.000000e+00 1430.0
9 TraesCS2B01G461000 chrUn 100.000 193 0 0 2084 2276 422207272 422207080 7.730000e-95 357.0
10 TraesCS2B01G461000 chrUn 100.000 193 0 0 2084 2276 422316652 422316460 7.730000e-95 357.0
11 TraesCS2B01G461000 chrUn 83.503 394 52 11 1743 2130 248125956 248125570 2.780000e-94 355.0
12 TraesCS2B01G461000 chrUn 94.681 94 4 1 1661 1753 37384503 37384410 6.550000e-31 145.0
13 TraesCS2B01G461000 chr2D 93.780 1688 71 12 2 1662 547792231 547790551 0.000000e+00 2505.0
14 TraesCS2B01G461000 chr2D 88.577 998 75 19 356 1326 547918286 547917301 0.000000e+00 1175.0
15 TraesCS2B01G461000 chr2D 82.365 1412 158 52 291 1662 547952536 547951176 0.000000e+00 1144.0
16 TraesCS2B01G461000 chr2D 79.498 1712 210 81 1 1642 547775982 547774342 0.000000e+00 1086.0
17 TraesCS2B01G461000 chr2D 86.902 962 92 14 714 1662 547806677 547805737 0.000000e+00 1048.0
18 TraesCS2B01G461000 chr2D 90.267 524 42 6 1747 2269 547899578 547899063 0.000000e+00 676.0
19 TraesCS2B01G461000 chr2D 89.753 527 45 4 1743 2269 547790553 547790036 0.000000e+00 665.0
20 TraesCS2B01G461000 chr2D 94.000 300 18 0 65 364 547945471 547945172 2.670000e-124 455.0
21 TraesCS2B01G461000 chr2D 95.652 92 3 1 1656 1746 592140690 592140599 1.820000e-31 147.0
22 TraesCS2B01G461000 chr2A 90.194 1601 116 21 2 1569 691118987 691120579 0.000000e+00 2049.0
23 TraesCS2B01G461000 chr2A 88.286 1383 103 20 324 1662 691139620 691140987 0.000000e+00 1602.0
24 TraesCS2B01G461000 chr2A 81.966 1414 169 49 290 1661 691115438 691116807 0.000000e+00 1120.0
25 TraesCS2B01G461000 chr2A 88.679 530 51 5 1743 2269 691140985 691141508 2.470000e-179 638.0
26 TraesCS2B01G461000 chr2A 93.958 331 18 2 2 332 691137493 691137821 1.210000e-137 499.0
27 TraesCS2B01G461000 chr2A 86.179 123 16 1 1540 1662 691120576 691120697 5.100000e-27 132.0
28 TraesCS2B01G461000 chr5B 95.699 93 2 2 1659 1749 554585561 554585653 5.070000e-32 148.0
29 TraesCS2B01G461000 chr3B 97.701 87 1 1 1661 1746 337289623 337289709 5.070000e-32 148.0
30 TraesCS2B01G461000 chr5A 85.882 85 11 1 231 315 78368158 78368241 3.110000e-14 89.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G461000 chr2B 654698039 654700314 2275 True 4204.000000 4204 100.000000 1 2276 1 chr2B.!!$R2 2275
1 TraesCS2B01G461000 chr2B 654725497 654727791 2294 True 3971.000000 3971 98.039000 2 2276 1 chr2B.!!$R3 2274
2 TraesCS2B01G461000 chr2B 654647915 654652522 4607 True 2174.500000 3999 90.753000 2 2276 2 chr2B.!!$R4 2274
3 TraesCS2B01G461000 chr2B 654545484 654546523 1039 True 1181.000000 1181 87.548000 638 1662 1 chr2B.!!$R1 1024
4 TraesCS2B01G461000 chrUn 281905476 281907021 1545 False 2765.000000 2765 98.965000 732 2276 1 chrUn.!!$F1 1544
5 TraesCS2B01G461000 chrUn 248121351 248125956 4605 True 2176.000000 3997 90.880000 2 2276 2 chrUn.!!$R4 2274
6 TraesCS2B01G461000 chrUn 346479534 346480392 858 False 1430.000000 1430 97.090000 2 841 1 chrUn.!!$F2 839
7 TraesCS2B01G461000 chr2D 547790036 547792231 2195 True 1585.000000 2505 91.766500 2 2269 2 chr2D.!!$R8 2267
8 TraesCS2B01G461000 chr2D 547917301 547918286 985 True 1175.000000 1175 88.577000 356 1326 1 chr2D.!!$R4 970
9 TraesCS2B01G461000 chr2D 547951176 547952536 1360 True 1144.000000 1144 82.365000 291 1662 1 chr2D.!!$R6 1371
10 TraesCS2B01G461000 chr2D 547774342 547775982 1640 True 1086.000000 1086 79.498000 1 1642 1 chr2D.!!$R1 1641
11 TraesCS2B01G461000 chr2D 547805737 547806677 940 True 1048.000000 1048 86.902000 714 1662 1 chr2D.!!$R2 948
12 TraesCS2B01G461000 chr2D 547899063 547899578 515 True 676.000000 676 90.267000 1747 2269 1 chr2D.!!$R3 522
13 TraesCS2B01G461000 chr2A 691115438 691120697 5259 False 1100.333333 2049 86.113000 2 1662 3 chr2A.!!$F1 1660
14 TraesCS2B01G461000 chr2A 691137493 691141508 4015 False 913.000000 1602 90.307667 2 2269 3 chr2A.!!$F2 2267

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
743 6335 5.173854 GGTTCGAGTGCAGATTTTTCTTTTG 59.826 40.0 0.0 0.0 0.0 2.44 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2082 7738 2.102588 AGGATTATCGGACCTCCAAACG 59.897 50.0 0.0 0.0 35.14 3.6 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
276 3978 6.777526 TTCCAAATTAAAAATGCCGAACAG 57.222 33.333 0.0 0.0 0.00 3.16
628 6187 5.525745 TCGCTTTCTATGATAATTTTGCGGA 59.474 36.000 0.0 0.0 40.05 5.54
702 6273 9.803130 GGTAGTTTTACTTCGTTACATTTCTTC 57.197 33.333 0.0 0.0 0.00 2.87
706 6277 9.848172 GTTTTACTTCGTTACATTTCTTCGTTA 57.152 29.630 0.0 0.0 0.00 3.18
708 6279 8.572828 TTACTTCGTTACATTTCTTCGTTACA 57.427 30.769 0.0 0.0 0.00 2.41
743 6335 5.173854 GGTTCGAGTGCAGATTTTTCTTTTG 59.826 40.000 0.0 0.0 0.00 2.44
1674 7328 1.405821 CAGCTAGTACTCCCTCCGTTG 59.594 57.143 0.0 0.0 0.00 4.10
2082 7738 3.007614 TCACTACTTGCTAGGTGGTTTCC 59.992 47.826 0.0 0.0 0.00 3.13
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
133 3833 7.279981 TGGTCAATTAATTAGACAAGGACATCG 59.720 37.037 21.62 1.53 34.04 3.84
628 6187 9.680315 GCGAAAATCTCTATAATGTAGTGTACT 57.320 33.333 0.00 0.00 0.00 2.73
702 6273 3.363575 CGAACCCACTGTGAAATGTAACG 60.364 47.826 9.86 6.98 0.00 3.18
706 6277 2.158813 ACTCGAACCCACTGTGAAATGT 60.159 45.455 9.86 0.00 0.00 2.71
708 6279 2.494059 CACTCGAACCCACTGTGAAAT 58.506 47.619 9.86 0.00 0.00 2.17
960 6557 2.159338 AGCCAATGCATTTGACTTAGCG 60.159 45.455 14.36 0.00 41.13 4.26
1909 7565 4.340894 ACAAACTGTTGTGCTATATGCG 57.659 40.909 0.00 0.00 46.40 4.73
2082 7738 2.102588 AGGATTATCGGACCTCCAAACG 59.897 50.000 0.00 0.00 35.14 3.60


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.