Multiple sequence alignment - TraesCS2B01G460800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G460800 chr2B 100.000 2318 0 0 1 2318 654654210 654651893 0.000000e+00 4281
1 TraesCS2B01G460800 chr2B 98.965 2318 24 0 1 2318 654704313 654701996 0.000000e+00 4148
2 TraesCS2B01G460800 chr2B 98.879 2319 25 1 1 2318 654682481 654680163 0.000000e+00 4137
3 TraesCS2B01G460800 chr2B 98.728 1179 12 2 1141 2318 654730650 654729474 0.000000e+00 2091
4 TraesCS2B01G460800 chr2B 97.396 1152 29 1 1 1151 654733232 654732081 0.000000e+00 1960
5 TraesCS2B01G460800 chr2B 84.976 1025 112 20 695 1691 654649540 654648530 0.000000e+00 1002
6 TraesCS2B01G460800 chr2B 94.181 653 33 5 1 650 53243267 53242617 0.000000e+00 990
7 TraesCS2B01G460800 chr2B 82.096 229 28 9 2095 2318 654587108 654586888 1.410000e-42 183
8 TraesCS2B01G460800 chrUn 98.921 2318 25 0 1 2318 248127644 248125327 0.000000e+00 4143
9 TraesCS2B01G460800 chrUn 95.084 651 27 5 1 649 23778589 23779236 0.000000e+00 1020
10 TraesCS2B01G460800 chrUn 85.171 1025 110 20 695 1691 248122975 248121965 0.000000e+00 1013
11 TraesCS2B01G460800 chr2D 94.163 1679 86 9 649 2316 547806785 547805108 0.000000e+00 2547
12 TraesCS2B01G460800 chr2D 92.628 1682 104 10 649 2316 547952222 547950547 0.000000e+00 2401
13 TraesCS2B01G460800 chr2D 84.961 1403 173 25 695 2075 547791561 547790175 0.000000e+00 1387
14 TraesCS2B01G460800 chr2D 81.586 744 97 22 1360 2075 547899933 547899202 1.540000e-161 579
15 TraesCS2B01G460800 chr2D 83.410 217 21 9 2098 2309 547790040 547789834 1.090000e-43 187
16 TraesCS2B01G460800 chr2A 89.418 1701 133 30 642 2318 691115747 691117424 0.000000e+00 2100
17 TraesCS2B01G460800 chr2A 87.745 971 83 20 1367 2318 691134199 691135152 0.000000e+00 1101
18 TraesCS2B01G460800 chr6B 94.582 646 33 2 1 645 487839954 487840598 0.000000e+00 998
19 TraesCS2B01G460800 chr3D 94.190 654 36 2 1 653 19890190 19889538 0.000000e+00 996
20 TraesCS2B01G460800 chr1B 94.308 650 34 3 1 649 612430701 612431348 0.000000e+00 992


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G460800 chr2B 654701996 654704313 2317 True 4148.0 4148 98.9650 1 2318 1 chr2B.!!$R4 2317
1 TraesCS2B01G460800 chr2B 654680163 654682481 2318 True 4137.0 4137 98.8790 1 2318 1 chr2B.!!$R3 2317
2 TraesCS2B01G460800 chr2B 654648530 654654210 5680 True 2641.5 4281 92.4880 1 2318 2 chr2B.!!$R5 2317
3 TraesCS2B01G460800 chr2B 654729474 654733232 3758 True 2025.5 2091 98.0620 1 2318 2 chr2B.!!$R6 2317
4 TraesCS2B01G460800 chr2B 53242617 53243267 650 True 990.0 990 94.1810 1 650 1 chr2B.!!$R1 649
5 TraesCS2B01G460800 chrUn 248121965 248127644 5679 True 2578.0 4143 92.0460 1 2318 2 chrUn.!!$R1 2317
6 TraesCS2B01G460800 chrUn 23778589 23779236 647 False 1020.0 1020 95.0840 1 649 1 chrUn.!!$F1 648
7 TraesCS2B01G460800 chr2D 547805108 547806785 1677 True 2547.0 2547 94.1630 649 2316 1 chr2D.!!$R1 1667
8 TraesCS2B01G460800 chr2D 547950547 547952222 1675 True 2401.0 2401 92.6280 649 2316 1 chr2D.!!$R3 1667
9 TraesCS2B01G460800 chr2D 547789834 547791561 1727 True 787.0 1387 84.1855 695 2309 2 chr2D.!!$R4 1614
10 TraesCS2B01G460800 chr2D 547899202 547899933 731 True 579.0 579 81.5860 1360 2075 1 chr2D.!!$R2 715
11 TraesCS2B01G460800 chr2A 691115747 691117424 1677 False 2100.0 2100 89.4180 642 2318 1 chr2A.!!$F1 1676
12 TraesCS2B01G460800 chr2A 691134199 691135152 953 False 1101.0 1101 87.7450 1367 2318 1 chr2A.!!$F2 951
13 TraesCS2B01G460800 chr6B 487839954 487840598 644 False 998.0 998 94.5820 1 645 1 chr6B.!!$F1 644
14 TraesCS2B01G460800 chr3D 19889538 19890190 652 True 996.0 996 94.1900 1 653 1 chr3D.!!$R1 652
15 TraesCS2B01G460800 chr1B 612430701 612431348 647 False 992.0 992 94.3080 1 649 1 chr1B.!!$F1 648

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
396 400 1.874019 GCAGCGTCGTCATCATCGT 60.874 57.895 0.0 0.0 0.0 3.73 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2171 3811 4.019411 ACATTGTGTGATCCACCAGACATA 60.019 41.667 10.6 0.0 43.85 2.29 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
129 130 3.798511 CCCGGCTCCCCTTCTTCC 61.799 72.222 0.00 0.0 0.0 3.46
392 396 2.810887 GCAGCAGCGTCGTCATCA 60.811 61.111 0.00 0.0 0.0 3.07
396 400 1.874019 GCAGCGTCGTCATCATCGT 60.874 57.895 0.00 0.0 0.0 3.73
443 447 4.117661 GGCGCTTCGGAGTCTCGT 62.118 66.667 7.64 0.0 0.0 4.18
937 946 5.916318 TCTCACACATTTCCAAAGCAAAAT 58.084 33.333 0.00 0.0 0.0 1.82
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
129 130 0.524816 GCGAAGATGGCATGCACAAG 60.525 55.000 21.36 4.77 0.00 3.16
392 396 0.905357 CCTCCAAGAAGGGACACGAT 59.095 55.000 0.00 0.00 38.24 3.73
396 400 1.142870 CAACACCTCCAAGAAGGGACA 59.857 52.381 0.00 0.00 41.04 4.02
443 447 1.120530 GAAGATCGTCCCCCAAGCTA 58.879 55.000 0.00 0.00 0.00 3.32
585 590 7.309177 CAAACATCCAATACAACCAACGATAA 58.691 34.615 0.00 0.00 0.00 1.75
937 946 5.772004 AGAGGAGATTTGGTCTTAGCTAGA 58.228 41.667 0.00 0.00 37.29 2.43
2169 3809 5.948742 TTGTGTGATCCACCAGACATATA 57.051 39.130 10.60 0.00 43.85 0.86
2171 3811 4.019411 ACATTGTGTGATCCACCAGACATA 60.019 41.667 10.60 0.00 43.85 2.29


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.