Multiple sequence alignment - TraesCS2B01G460700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G460700 chr2B 100.000 2318 0 0 1 2318 654650233 654647916 0.000000e+00 4281.0
1 TraesCS2B01G460700 chr2B 98.965 2318 24 0 1 2318 654727815 654725498 0.000000e+00 4148.0
2 TraesCS2B01G460700 chr2B 98.231 2318 21 6 1 2318 654700337 654698040 0.000000e+00 4036.0
3 TraesCS2B01G460700 chr2B 88.742 1057 89 13 661 1704 654546523 654545484 0.000000e+00 1266.0
4 TraesCS2B01G460700 chr2B 84.010 394 50 11 1786 2173 654652522 654652136 1.310000e-97 366.0
5 TraesCS2B01G460700 chr2B 100.000 192 0 0 2127 2318 654679383 654679192 2.830000e-94 355.0
6 TraesCS2B01G460700 chr2B 97.849 93 2 0 1704 1796 760948660 760948752 6.630000e-36 161.0
7 TraesCS2B01G460700 chrUn 99.741 2318 5 1 1 2318 248123668 248121352 0.000000e+00 4246.0
8 TraesCS2B01G460700 chrUn 99.482 1545 8 0 774 2318 281905476 281907020 0.000000e+00 2809.0
9 TraesCS2B01G460700 chrUn 100.000 883 0 0 1 883 346479510 346480392 0.000000e+00 1631.0
10 TraesCS2B01G460700 chrUn 84.264 394 49 11 1786 2173 248125956 248125570 2.810000e-99 372.0
11 TraesCS2B01G460700 chrUn 100.000 192 0 0 2127 2318 422207272 422207081 2.830000e-94 355.0
12 TraesCS2B01G460700 chrUn 96.809 94 3 0 1703 1796 37384503 37384410 8.570000e-35 158.0
13 TraesCS2B01G460700 chr2D 95.038 1713 68 9 1 1704 547792255 547790551 0.000000e+00 2676.0
14 TraesCS2B01G460700 chr2D 90.190 999 76 11 379 1368 547918286 547917301 0.000000e+00 1282.0
15 TraesCS2B01G460700 chr2D 83.298 1413 162 47 314 1704 547952536 547951176 0.000000e+00 1234.0
16 TraesCS2B01G460700 chr2D 80.220 1729 214 65 10 1684 547775996 547774342 0.000000e+00 1181.0
17 TraesCS2B01G460700 chr2D 90.458 524 41 6 1790 2312 547899578 547899063 0.000000e+00 682.0
18 TraesCS2B01G460700 chr2D 89.943 527 44 4 1786 2312 547790553 547790036 0.000000e+00 671.0
19 TraesCS2B01G460700 chr2D 94.667 300 16 0 88 387 547945471 547945172 1.250000e-127 466.0
20 TraesCS2B01G460700 chr2D 97.826 92 2 0 1698 1789 592140690 592140599 2.380000e-35 159.0
21 TraesCS2B01G460700 chr2A 89.679 1744 131 25 1 1704 691118963 691120697 0.000000e+00 2178.0
22 TraesCS2B01G460700 chr2A 89.283 1381 112 17 347 1704 691139620 691140987 0.000000e+00 1698.0
23 TraesCS2B01G460700 chr2A 82.732 1413 179 39 313 1703 691115438 691116807 0.000000e+00 1197.0
24 TraesCS2B01G460700 chr2A 88.868 530 50 5 1786 2312 691140985 691141508 0.000000e+00 643.0
25 TraesCS2B01G460700 chr2A 94.930 355 16 2 1 355 691137469 691137821 2.600000e-154 555.0
26 TraesCS2B01G460700 chr3B 100.000 87 0 0 1703 1789 337289623 337289709 6.630000e-36 161.0
27 TraesCS2B01G460700 chr5B 97.849 93 1 1 1701 1792 554585561 554585653 2.380000e-35 159.0
28 TraesCS2B01G460700 chr5A 87.059 85 10 1 254 338 78368158 78368241 6.820000e-16 95.3


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G460700 chr2B 654725498 654727815 2317 True 4148.000000 4148 98.9650 1 2318 1 chr2B.!!$R4 2317
1 TraesCS2B01G460700 chr2B 654698040 654700337 2297 True 4036.000000 4036 98.2310 1 2318 1 chr2B.!!$R3 2317
2 TraesCS2B01G460700 chr2B 654647916 654652522 4606 True 2323.500000 4281 92.0050 1 2318 2 chr2B.!!$R5 2317
3 TraesCS2B01G460700 chr2B 654545484 654546523 1039 True 1266.000000 1266 88.7420 661 1704 1 chr2B.!!$R1 1043
4 TraesCS2B01G460700 chrUn 281905476 281907020 1544 False 2809.000000 2809 99.4820 774 2318 1 chrUn.!!$F1 1544
5 TraesCS2B01G460700 chrUn 248121352 248125956 4604 True 2309.000000 4246 92.0025 1 2318 2 chrUn.!!$R3 2317
6 TraesCS2B01G460700 chrUn 346479510 346480392 882 False 1631.000000 1631 100.0000 1 883 1 chrUn.!!$F2 882
7 TraesCS2B01G460700 chr2D 547790036 547792255 2219 True 1673.500000 2676 92.4905 1 2312 2 chr2D.!!$R7 2311
8 TraesCS2B01G460700 chr2D 547917301 547918286 985 True 1282.000000 1282 90.1900 379 1368 1 chr2D.!!$R3 989
9 TraesCS2B01G460700 chr2D 547951176 547952536 1360 True 1234.000000 1234 83.2980 314 1704 1 chr2D.!!$R5 1390
10 TraesCS2B01G460700 chr2D 547774342 547775996 1654 True 1181.000000 1181 80.2200 10 1684 1 chr2D.!!$R1 1674
11 TraesCS2B01G460700 chr2D 547899063 547899578 515 True 682.000000 682 90.4580 1790 2312 1 chr2D.!!$R2 522
12 TraesCS2B01G460700 chr2A 691115438 691120697 5259 False 1687.500000 2178 86.2055 1 1704 2 chr2A.!!$F1 1703
13 TraesCS2B01G460700 chr2A 691137469 691141508 4039 False 965.333333 1698 91.0270 1 2312 3 chr2A.!!$F2 2311

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
140 3817 4.399303 GCATCTAGTTGCAGGGTTTATTGT 59.601 41.667 18.81 0.0 42.31 2.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1885 7495 1.004918 AGGTGTTGCGGTAGTCTGC 60.005 57.895 0.0 0.0 45.37 4.26 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
140 3817 4.399303 GCATCTAGTTGCAGGGTTTATTGT 59.601 41.667 18.81 0.0 42.31 2.71
294 3973 8.703378 AAGGATTTTCCAAATTAAAAATGCCA 57.297 26.923 15.31 0.0 41.41 4.92
718 6265 6.951256 AATCGGTACTTTTACTTCGTTACC 57.049 37.500 0.00 0.0 0.00 2.85
1212 6766 3.069289 TCTATCATGCATTTGCCGCTAG 58.931 45.455 0.00 0.0 41.18 3.42
1299 6853 0.391130 GCAAGTGCGGTCTCACCATA 60.391 55.000 0.00 0.0 38.47 2.74
1357 6926 3.619900 ACCCATGAGCATCTAGGAGTA 57.380 47.619 0.00 0.0 34.92 2.59
1737 7346 4.571919 TCCGATTTACTCGTCATGGTTTT 58.428 39.130 0.00 0.0 46.18 2.43
1885 7495 1.686587 TGCACGTCCTATGGTATCCAG 59.313 52.381 0.00 0.0 36.75 3.86
2124 7734 4.102681 ACTCACTACTTGCTAGGTGGTTTT 59.897 41.667 0.00 0.0 0.00 2.43
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
140 3817 2.168521 ACATCCGCTAGCTAGCTTGAAA 59.831 45.455 36.02 20.18 46.85 2.69
703 6250 9.006215 CAACAAAGAAAGGTAACGAAGTAAAAG 57.994 33.333 0.00 0.00 45.00 2.27
1299 6853 2.158623 TCATCAAGAGCAGTTGTTGGGT 60.159 45.455 8.46 0.00 31.27 4.51
1357 6926 2.502947 TGATGCAGATGTAGAGCAACCT 59.497 45.455 0.00 0.00 42.15 3.50
1682 7290 2.038952 ACTAGCTGCACAAATGGACAGA 59.961 45.455 1.02 0.00 31.67 3.41
1885 7495 1.004918 AGGTGTTGCGGTAGTCTGC 60.005 57.895 0.00 0.00 45.37 4.26
2124 7734 4.553678 AGGATTATCGGACCTCCAAACTA 58.446 43.478 0.00 0.00 35.14 2.24


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.