Multiple sequence alignment - TraesCS2B01G449400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G449400 chr2B 100.000 5615 0 0 1 5615 642556431 642562045 0.000000e+00 10370.0
1 TraesCS2B01G449400 chr2B 99.252 5617 36 4 1 5615 642472818 642478430 0.000000e+00 10135.0
2 TraesCS2B01G449400 chr2D 92.325 5642 373 26 1 5615 517684237 517678629 0.000000e+00 7965.0
3 TraesCS2B01G449400 chr2D 93.244 4248 203 34 1402 5610 539000410 539004612 0.000000e+00 6178.0
4 TraesCS2B01G449400 chr2D 91.529 2597 142 31 2733 5295 538936480 538939032 0.000000e+00 3506.0
5 TraesCS2B01G449400 chr2D 92.777 1703 98 12 1 1689 538933500 538935191 0.000000e+00 2440.0
6 TraesCS2B01G449400 chr2D 91.055 1688 122 9 3268 4954 517703909 517702250 0.000000e+00 2254.0
7 TraesCS2B01G449400 chr2D 96.992 1197 35 1 178 1373 538999218 539000414 0.000000e+00 2010.0
8 TraesCS2B01G449400 chr2D 88.920 1444 129 14 1552 2977 517770940 517769510 0.000000e+00 1751.0
9 TraesCS2B01G449400 chr2D 87.227 1558 146 23 1 1555 517772539 517771032 0.000000e+00 1725.0
10 TraesCS2B01G449400 chr2D 93.049 1079 71 3 3268 4344 538942349 538943425 0.000000e+00 1574.0
11 TraesCS2B01G449400 chr2D 90.751 1092 52 16 1689 2733 538935267 538936356 0.000000e+00 1411.0
12 TraesCS2B01G449400 chr2D 87.007 608 60 6 4349 4954 538943503 538944093 0.000000e+00 667.0
13 TraesCS2B01G449400 chr2D 92.542 295 20 2 2972 3266 517761192 517760900 6.730000e-114 422.0
14 TraesCS2B01G449400 chr2D 96.721 183 5 1 1 182 538997944 538998126 2.540000e-78 303.0
15 TraesCS2B01G449400 chr2D 82.828 99 12 3 5202 5295 538944232 538944330 3.600000e-12 84.2
16 TraesCS2B01G449400 chr2A 92.719 4656 286 26 985 5615 681479229 681483856 0.000000e+00 6671.0
17 TraesCS2B01G449400 chr2A 90.990 2131 166 13 2733 4855 682129702 682131814 0.000000e+00 2848.0
18 TraesCS2B01G449400 chr2A 90.366 1692 131 10 3268 4954 682099420 682101084 0.000000e+00 2193.0
19 TraesCS2B01G449400 chr2A 89.723 1732 142 22 1552 3262 682097068 682098784 0.000000e+00 2180.0
20 TraesCS2B01G449400 chr2A 90.526 1351 119 6 1388 2734 682128294 682129639 0.000000e+00 1777.0
21 TraesCS2B01G449400 chr2A 89.168 997 98 8 558 1553 682095987 682096974 0.000000e+00 1234.0
22 TraesCS2B01G449400 chr2A 86.576 514 41 9 1 513 682095506 682095992 4.950000e-150 542.0
23 TraesCS2B01G449400 chr2A 89.352 432 39 6 1 430 681478591 681479017 2.300000e-148 536.0
24 TraesCS2B01G449400 chr2A 89.535 430 36 4 1 426 682127873 682128297 2.300000e-148 536.0
25 TraesCS2B01G449400 chr2A 92.891 211 15 0 5006 5216 682147086 682147296 1.960000e-79 307.0
26 TraesCS2B01G449400 chr7A 88.815 3308 268 38 566 3846 669453384 669450152 0.000000e+00 3965.0
27 TraesCS2B01G449400 chr7A 88.749 951 76 11 3841 4782 669442677 669441749 0.000000e+00 1134.0
28 TraesCS2B01G449400 chr7A 90.270 370 30 3 1 369 669453744 669453380 3.930000e-131 479.0
29 TraesCS2B01G449400 chr7A 90.141 71 6 1 5515 5584 40356567 40356497 2.150000e-14 91.6
30 TraesCS2B01G449400 chrUn 100.000 400 0 0 1784 2183 478784249 478783850 0.000000e+00 739.0
31 TraesCS2B01G449400 chr5A 87.692 130 6 7 5466 5586 51459494 51459622 5.860000e-30 143.0
32 TraesCS2B01G449400 chr6D 84.722 72 7 4 5499 5569 350908627 350908559 1.010000e-07 69.4
33 TraesCS2B01G449400 chr7B 93.333 45 3 0 5539 5583 20636704 20636748 3.630000e-07 67.6
34 TraesCS2B01G449400 chr4D 95.238 42 0 2 5505 5545 47990444 47990484 1.310000e-06 65.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G449400 chr2B 642556431 642562045 5614 False 10370.000000 10370 100.000000 1 5615 1 chr2B.!!$F2 5614
1 TraesCS2B01G449400 chr2B 642472818 642478430 5612 False 10135.000000 10135 99.252000 1 5615 1 chr2B.!!$F1 5614
2 TraesCS2B01G449400 chr2D 517678629 517684237 5608 True 7965.000000 7965 92.325000 1 5615 1 chr2D.!!$R1 5614
3 TraesCS2B01G449400 chr2D 538997944 539004612 6668 False 2830.333333 6178 95.652333 1 5610 3 chr2D.!!$F2 5609
4 TraesCS2B01G449400 chr2D 517702250 517703909 1659 True 2254.000000 2254 91.055000 3268 4954 1 chr2D.!!$R2 1686
5 TraesCS2B01G449400 chr2D 517769510 517772539 3029 True 1738.000000 1751 88.073500 1 2977 2 chr2D.!!$R4 2976
6 TraesCS2B01G449400 chr2D 538933500 538944330 10830 False 1613.700000 3506 89.656833 1 5295 6 chr2D.!!$F1 5294
7 TraesCS2B01G449400 chr2A 681478591 681483856 5265 False 3603.500000 6671 91.035500 1 5615 2 chr2A.!!$F2 5614
8 TraesCS2B01G449400 chr2A 682127873 682131814 3941 False 1720.333333 2848 90.350333 1 4855 3 chr2A.!!$F4 4854
9 TraesCS2B01G449400 chr2A 682095506 682101084 5578 False 1537.250000 2193 88.958250 1 4954 4 chr2A.!!$F3 4953
10 TraesCS2B01G449400 chr7A 669450152 669453744 3592 True 2222.000000 3965 89.542500 1 3846 2 chr7A.!!$R3 3845
11 TraesCS2B01G449400 chr7A 669441749 669442677 928 True 1134.000000 1134 88.749000 3841 4782 1 chr7A.!!$R2 941

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
49 50 9.071276 ACCATCATCACATCAATTATTTCCTAC 57.929 33.333 0.00 0.00 0.00 3.18 F
2483 4000 0.321210 TCGTGCGTTGATTGACCCAT 60.321 50.000 0.00 0.00 0.00 4.00 F
4235 6552 0.095935 CCACGATTGCAAGCTTCTCG 59.904 55.000 13.57 14.81 35.56 4.04 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1782 3234 5.787953 ATCAACCAATCACACAACATCAA 57.212 34.783 0.00 0.0 0.00 2.57 R
4235 6552 4.036144 GCCTGCAGAAAGGATCTCATTTAC 59.964 45.833 17.39 0.0 40.02 2.01 R
5588 12716 8.662781 TTTACATCATCTATTGGAGTGCTAAC 57.337 34.615 0.00 0.0 0.00 2.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
49 50 9.071276 ACCATCATCACATCAATTATTTCCTAC 57.929 33.333 0.00 0.00 0.00 3.18
2483 4000 0.321210 TCGTGCGTTGATTGACCCAT 60.321 50.000 0.00 0.00 0.00 4.00
4235 6552 0.095935 CCACGATTGCAAGCTTCTCG 59.904 55.000 13.57 14.81 35.56 4.04
5588 12716 6.256975 TCCAACGAATCATGTAAAATAGGACG 59.743 38.462 0.00 0.00 0.00 4.79
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
49 50 9.622004 TTTGAGTAGTTAGTATCTCGAGTTTTG 57.378 33.333 13.13 0.00 0.00 2.44
204 1308 3.083997 GGACCGGCCATGGAGAGT 61.084 66.667 18.40 8.44 36.34 3.24
899 2015 6.669278 AGGAACGAGAATAAAAAGAACAAGC 58.331 36.000 0.00 0.00 0.00 4.01
1782 3234 5.787953 ATCAACCAATCACACAACATCAA 57.212 34.783 0.00 0.00 0.00 2.57
4235 6552 4.036144 GCCTGCAGAAAGGATCTCATTTAC 59.964 45.833 17.39 0.00 40.02 2.01
5588 12716 8.662781 TTTACATCATCTATTGGAGTGCTAAC 57.337 34.615 0.00 0.00 0.00 2.34


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.