Multiple sequence alignment - TraesCS2B01G439300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G439300 chr2B 100.000 2322 0 0 1 2322 631382564 631380243 0 4289
1 TraesCS2B01G439300 chr2B 98.182 2310 40 2 1 2309 90758840 90761148 0 4032
2 TraesCS2B01G439300 chr1B 98.268 2310 39 1 1 2309 618191027 618188718 0 4043
3 TraesCS2B01G439300 chr1B 98.226 2311 39 2 1 2309 615476936 615479246 0 4039
4 TraesCS2B01G439300 chr1B 97.360 2311 53 4 1 2309 122762319 122764623 0 3923
5 TraesCS2B01G439300 chr7B 98.095 2310 43 1 1 2309 678100720 678103029 0 4021
6 TraesCS2B01G439300 chr7B 98.009 2310 45 1 1 2309 134328684 134326375 0 4010
7 TraesCS2B01G439300 chr7B 97.382 2330 53 3 1 2322 664294587 664296916 0 3958
8 TraesCS2B01G439300 chr7B 97.288 2323 61 2 1 2322 680722560 680724881 0 3940
9 TraesCS2B01G439300 chr5B 97.718 2323 50 3 1 2322 415774296 415771976 0 3993


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G439300 chr2B 631380243 631382564 2321 True 4289 4289 100.000 1 2322 1 chr2B.!!$R1 2321
1 TraesCS2B01G439300 chr2B 90758840 90761148 2308 False 4032 4032 98.182 1 2309 1 chr2B.!!$F1 2308
2 TraesCS2B01G439300 chr1B 618188718 618191027 2309 True 4043 4043 98.268 1 2309 1 chr1B.!!$R1 2308
3 TraesCS2B01G439300 chr1B 615476936 615479246 2310 False 4039 4039 98.226 1 2309 1 chr1B.!!$F2 2308
4 TraesCS2B01G439300 chr1B 122762319 122764623 2304 False 3923 3923 97.360 1 2309 1 chr1B.!!$F1 2308
5 TraesCS2B01G439300 chr7B 678100720 678103029 2309 False 4021 4021 98.095 1 2309 1 chr7B.!!$F2 2308
6 TraesCS2B01G439300 chr7B 134326375 134328684 2309 True 4010 4010 98.009 1 2309 1 chr7B.!!$R1 2308
7 TraesCS2B01G439300 chr7B 664294587 664296916 2329 False 3958 3958 97.382 1 2322 1 chr7B.!!$F1 2321
8 TraesCS2B01G439300 chr7B 680722560 680724881 2321 False 3940 3940 97.288 1 2322 1 chr7B.!!$F3 2321
9 TraesCS2B01G439300 chr5B 415771976 415774296 2320 True 3993 3993 97.718 1 2322 1 chr5B.!!$R1 2321

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
566 574 1.076995 TCTTCCGATCGAGGGCAGA 60.077 57.895 18.66 7.1 0.0 4.26 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1834 1843 3.200593 GCACCATCAGCAGCCTCG 61.201 66.667 0.0 0.0 0.0 4.63 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
189 190 8.212995 TGATGATTATTACAAGGAGAAGCATCA 58.787 33.333 9.15 9.15 45.51 3.07
481 489 1.694169 ACCATTGGAGGCCGGAGAT 60.694 57.895 5.05 0.00 0.00 2.75
546 554 3.196469 GGAGGATATTGCGATGATCTCCA 59.804 47.826 18.59 0.00 0.00 3.86
566 574 1.076995 TCTTCCGATCGAGGGCAGA 60.077 57.895 18.66 7.10 0.00 4.26
865 873 5.717119 TCTTCGTAACTGGGATGTTAAGTC 58.283 41.667 0.00 0.00 34.67 3.01
1224 1232 3.463944 GCGGTACAAGGCATACATAAGT 58.536 45.455 0.00 0.00 0.00 2.24
1482 1490 5.240623 TGTTTCGAAGCAATTTGGAGTACAT 59.759 36.000 12.63 0.00 0.00 2.29
1493 1501 0.249398 GGAGTACATCAACGCACCCT 59.751 55.000 0.00 0.00 0.00 4.34
1496 1505 0.673644 GTACATCAACGCACCCTGCT 60.674 55.000 0.00 0.00 42.25 4.24
1558 1567 8.281212 AGAGTTTTTGTACCATATGTTGATCC 57.719 34.615 1.24 0.00 0.00 3.36
2191 2202 3.890756 TGCAGAAGGTTGTGAATCATTGT 59.109 39.130 0.00 0.00 0.00 2.71
2236 2247 1.594194 GCCATGGCGGTTCATCAACA 61.594 55.000 23.48 0.00 36.97 3.33
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
129 130 4.974645 TTATCCGGCTCAAACATCCTAT 57.025 40.909 0.00 0.00 0.00 2.57
189 190 1.884579 CTCTTTCCACAAGCACAGCAT 59.115 47.619 0.00 0.00 0.00 3.79
398 406 5.078411 TGCCTTTAAAGTTGAGCACAAAA 57.922 34.783 14.03 0.00 37.77 2.44
466 474 2.377810 TGCATCTCCGGCCTCCAAT 61.378 57.895 0.00 0.00 0.00 3.16
481 489 1.949525 GAGCAAGGTGAAAAGAGTGCA 59.050 47.619 0.00 0.00 34.44 4.57
546 554 1.379977 TGCCCTCGATCGGAAGACT 60.380 57.895 16.41 0.00 46.97 3.24
566 574 4.890207 ACCTTCCCGGTAAGAGCT 57.110 55.556 8.60 0.00 46.73 4.09
950 958 9.467796 TTGTATACCCATTAAACAATCACATGA 57.532 29.630 0.00 0.00 0.00 3.07
968 976 4.436852 CGTCCAACTGCACATTTGTATACC 60.437 45.833 0.00 0.00 0.00 2.73
1224 1232 4.893608 TGTAAGTAAGCATGTCAAGCTCA 58.106 39.130 2.51 0.00 42.53 4.26
1493 1501 3.324846 ACTTGTCTCAACATACTCCAGCA 59.675 43.478 0.00 0.00 34.73 4.41
1496 1505 4.503123 CCACACTTGTCTCAACATACTCCA 60.503 45.833 0.00 0.00 34.73 3.86
1834 1843 3.200593 GCACCATCAGCAGCCTCG 61.201 66.667 0.00 0.00 0.00 4.63
2191 2202 3.506455 AGAGTAAAGCAGCTAGTGTTCGA 59.494 43.478 0.00 0.00 0.00 3.71
2236 2247 3.716006 GCACGTGCACGCACATCT 61.716 61.111 37.35 15.76 46.47 2.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.