Multiple sequence alignment - TraesCS2B01G427900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G427900 chr2B 100.000 4771 0 0 1 4771 615344293 615339523 0 8811
1 TraesCS2B01G427900 chr2B 98.681 4775 51 9 1 4771 616522999 616518233 0 8458
2 TraesCS2B01G427900 chr7B 98.744 4776 48 10 1 4771 628741840 628746608 0 8477
3 TraesCS2B01G427900 chr7B 98.554 4773 62 7 1 4771 75052087 75047320 0 8425
4 TraesCS2B01G427900 chr7A 98.723 4776 52 8 1 4771 28244724 28249495 0 8473
5 TraesCS2B01G427900 chr3A 98.659 4774 51 10 1 4771 742303658 742308421 0 8449
6 TraesCS2B01G427900 chr6B 98.555 4776 57 10 1 4771 482838190 482833422 0 8427
7 TraesCS2B01G427900 chr6B 98.408 4774 66 7 1 4771 482818557 482813791 0 8386
8 TraesCS2B01G427900 chr2A 98.325 4776 69 10 1 4771 167353551 167348782 0 8366
9 TraesCS2B01G427900 chr2A 98.781 4430 46 8 1 4427 70021019 70016595 0 7875


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G427900 chr2B 615339523 615344293 4770 True 8811 8811 100.000 1 4771 1 chr2B.!!$R1 4770
1 TraesCS2B01G427900 chr2B 616518233 616522999 4766 True 8458 8458 98.681 1 4771 1 chr2B.!!$R2 4770
2 TraesCS2B01G427900 chr7B 628741840 628746608 4768 False 8477 8477 98.744 1 4771 1 chr7B.!!$F1 4770
3 TraesCS2B01G427900 chr7B 75047320 75052087 4767 True 8425 8425 98.554 1 4771 1 chr7B.!!$R1 4770
4 TraesCS2B01G427900 chr7A 28244724 28249495 4771 False 8473 8473 98.723 1 4771 1 chr7A.!!$F1 4770
5 TraesCS2B01G427900 chr3A 742303658 742308421 4763 False 8449 8449 98.659 1 4771 1 chr3A.!!$F1 4770
6 TraesCS2B01G427900 chr6B 482833422 482838190 4768 True 8427 8427 98.555 1 4771 1 chr6B.!!$R2 4770
7 TraesCS2B01G427900 chr6B 482813791 482818557 4766 True 8386 8386 98.408 1 4771 1 chr6B.!!$R1 4770
8 TraesCS2B01G427900 chr2A 167348782 167353551 4769 True 8366 8366 98.325 1 4771 1 chr2A.!!$R2 4770
9 TraesCS2B01G427900 chr2A 70016595 70021019 4424 True 7875 7875 98.781 1 4427 1 chr2A.!!$R1 4426

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
330 337 0.110599 TAACAAACGACGCCGCAATG 60.111 50.000 0.0 0.0 39.95 2.82 F
509 517 0.322322 TGACCCGTCGCCTTGTTTAT 59.678 50.000 0.0 0.0 0.00 1.40 F
2029 2039 1.590147 CGGCGTCTCCTACAAACCT 59.410 57.895 0.0 0.0 0.00 3.50 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2029 2039 3.726557 TCGTCCTCTTCCAGGTTACTA 57.273 47.619 0.00 0.00 43.95 1.82 R
2664 2674 7.498239 TGCCATCATTGAAAATTTCTGTTTTGA 59.502 29.630 7.29 3.86 31.80 2.69 R
3924 3936 6.169800 TGAAACGAAATATCATGTGGACAGA 58.830 36.000 0.00 0.00 0.00 3.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
329 336 0.165079 CTAACAAACGACGCCGCAAT 59.835 50.000 0.00 0.00 39.95 3.56
330 337 0.110599 TAACAAACGACGCCGCAATG 60.111 50.000 0.00 0.00 39.95 2.82
509 517 0.322322 TGACCCGTCGCCTTGTTTAT 59.678 50.000 0.00 0.00 0.00 1.40
628 637 2.835431 CCTCTCCCATCGTCGCCT 60.835 66.667 0.00 0.00 0.00 5.52
765 774 4.794334 TGTTCAAAAGTGGGTTAGCCTAA 58.206 39.130 1.07 0.00 34.45 2.69
1015 1024 5.466393 GGAAAAACAATGGAGTGGATGTTTG 59.534 40.000 3.78 0.00 43.16 2.93
1091 1100 9.660180 AGTTTTGTTAGCAAGAAAAATGGTAAA 57.340 25.926 5.82 0.00 41.00 2.01
1659 1669 8.465999 TGAAATAAAGTAAAGTGTGCATATGGG 58.534 33.333 4.56 0.00 0.00 4.00
1934 1944 4.806869 AGGTAACACTTGAGCACGTCTCA 61.807 47.826 11.95 11.95 45.29 3.27
2029 2039 1.590147 CGGCGTCTCCTACAAACCT 59.410 57.895 0.00 0.00 0.00 3.50
2664 2674 5.118971 CGCATGAGCATTTACAAAAACATGT 59.881 36.000 0.00 0.00 42.27 3.21
2882 2892 7.744715 GTCGACAAAGTTAATGATGATCGTTTT 59.255 33.333 11.55 0.00 0.00 2.43
3644 3654 2.566913 TGAACGTTGTGCTAACACCAT 58.433 42.857 5.00 0.00 46.86 3.55
4020 4032 9.366216 GCCGAATAGTTATATGTAATCATGTCA 57.634 33.333 0.00 0.00 35.70 3.58
4196 4211 2.268076 CGTGGAAACCAGGCCCAAG 61.268 63.158 0.00 0.00 32.34 3.61
4217 4232 3.264897 GCAGAATCGACGCGGCAT 61.265 61.111 14.85 1.03 0.00 4.40
4739 4755 2.596338 TCACGCTGTGGAGACGGA 60.596 61.111 8.46 0.00 33.87 4.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
3 4 2.818751 ACCCAGAAAATAATGCCCGA 57.181 45.000 0.00 0.00 0.00 5.14
10 11 4.283212 CCAGGCAGAAAACCCAGAAAATAA 59.717 41.667 0.00 0.00 0.00 1.40
509 517 2.343758 GGAGAGGCAGCGACAACA 59.656 61.111 0.00 0.00 0.00 3.33
1015 1024 5.245526 TCTCCTTCAGTACTAAGAAACCCAC 59.754 44.000 0.00 0.00 0.00 4.61
1934 1944 8.812513 TCTTCAATTCAGTGATGGACATTAAT 57.187 30.769 0.00 0.00 0.00 1.40
2029 2039 3.726557 TCGTCCTCTTCCAGGTTACTA 57.273 47.619 0.00 0.00 43.95 1.82
2664 2674 7.498239 TGCCATCATTGAAAATTTCTGTTTTGA 59.502 29.630 7.29 3.86 31.80 2.69
2882 2892 9.173021 CAATGTATCCTCCAAGTTGTTAACATA 57.827 33.333 9.56 0.00 0.00 2.29
3261 3271 9.538508 AGTGTACTAAAGAAAACGAATGTTACT 57.461 29.630 0.00 0.00 37.31 2.24
3723 3734 9.672086 CCGAATAACTTTGTTTTTCACTTCATA 57.328 29.630 11.79 0.00 0.00 2.15
3923 3935 6.652900 TGAAACGAAATATCATGTGGACAGAA 59.347 34.615 0.00 0.00 0.00 3.02
3924 3936 6.169800 TGAAACGAAATATCATGTGGACAGA 58.830 36.000 0.00 0.00 0.00 3.41
4020 4032 8.865590 AGTTTAGTGCACAAAAATTTAACGAT 57.134 26.923 21.04 0.00 0.00 3.73
4196 4211 2.517450 CCGCGTCGATTCTGCCTTC 61.517 63.158 4.92 0.00 0.00 3.46
4217 4232 3.415212 CCTGATTACTACCCCGTCGATA 58.585 50.000 0.00 0.00 0.00 2.92


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.