Multiple sequence alignment - TraesCS2B01G427400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G427400 chr2B 100.000 2030 0 0 439 2468 614643420 614645449 0.000000e+00 3749
1 TraesCS2B01G427400 chr2B 97.488 2030 51 0 439 2468 109887154 109889183 0.000000e+00 3467
2 TraesCS2B01G427400 chr2B 100.000 66 0 0 1 66 614642982 614643047 3.330000e-24 122
3 TraesCS2B01G427400 chr2B 98.485 66 1 0 1 66 109887014 109887079 1.550000e-22 117
4 TraesCS2B01G427400 chr5B 97.833 2030 44 0 439 2468 525549608 525547579 0.000000e+00 3506
5 TraesCS2B01G427400 chr5B 98.485 66 1 0 1 66 525549739 525549674 1.550000e-22 117
6 TraesCS2B01G427400 chr1B 96.946 2030 62 0 439 2468 126921839 126923868 0.000000e+00 3406
7 TraesCS2B01G427400 chr1B 100.000 66 0 0 1 66 126921694 126921759 3.330000e-24 122
8 TraesCS2B01G427400 chr1D 95.126 1190 56 2 439 1626 288858754 288859943 0.000000e+00 1875
9 TraesCS2B01G427400 chr1D 97.236 832 23 0 1637 2468 288860317 288861148 0.000000e+00 1410
10 TraesCS2B01G427400 chr1D 97.015 67 1 1 1 66 288858607 288858673 7.210000e-21 111
11 TraesCS2B01G427400 chr2A 96.454 1128 38 2 441 1567 354529369 354530495 0.000000e+00 1860
12 TraesCS2B01G427400 chr2A 96.025 1132 44 1 439 1570 494100852 494099722 0.000000e+00 1840
13 TraesCS2B01G427400 chr2A 96.394 832 24 1 1637 2468 354530501 354531326 0.000000e+00 1365
14 TraesCS2B01G427400 chr2A 97.021 235 6 1 1637 1871 494099719 494099486 6.400000e-106 394
15 TraesCS2B01G427400 chr2A 95.522 67 2 1 1 66 354529221 354529287 3.360000e-19 106
16 TraesCS2B01G427400 chr2A 95.522 67 2 1 1 66 494100998 494100932 3.360000e-19 106
17 TraesCS2B01G427400 chr2A 94.030 67 2 2 1 66 745975590 745975525 1.560000e-17 100
18 TraesCS2B01G427400 chr7D 94.132 1193 66 4 439 1629 61523777 61522587 0.000000e+00 1812
19 TraesCS2B01G427400 chr7D 97.236 832 23 0 1637 2468 61522216 61521385 0.000000e+00 1410
20 TraesCS2B01G427400 chr7D 95.522 67 2 1 1 66 61523923 61523857 3.360000e-19 106
21 TraesCS2B01G427400 chr7A 95.221 1130 49 4 439 1567 320507979 320509104 0.000000e+00 1783
22 TraesCS2B01G427400 chr7A 96.154 832 32 0 1637 2468 320509110 320509941 0.000000e+00 1360
23 TraesCS2B01G427400 chr7A 98.507 67 0 1 1 66 320507831 320507897 1.550000e-22 117
24 TraesCS2B01G427400 chr1A 93.583 1200 64 4 439 1626 408631463 408632661 0.000000e+00 1777
25 TraesCS2B01G427400 chr4D 96.514 832 29 0 1637 2468 382847075 382846244 0.000000e+00 1376
26 TraesCS2B01G427400 chr6D 93.457 703 36 3 1775 2468 93876313 93877014 0.000000e+00 1035


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G427400 chr2B 614642982 614645449 2467 False 1935.500000 3749 100.000000 1 2468 2 chr2B.!!$F2 2467
1 TraesCS2B01G427400 chr2B 109887014 109889183 2169 False 1792.000000 3467 97.986500 1 2468 2 chr2B.!!$F1 2467
2 TraesCS2B01G427400 chr5B 525547579 525549739 2160 True 1811.500000 3506 98.159000 1 2468 2 chr5B.!!$R1 2467
3 TraesCS2B01G427400 chr1B 126921694 126923868 2174 False 1764.000000 3406 98.473000 1 2468 2 chr1B.!!$F1 2467
4 TraesCS2B01G427400 chr1D 288858607 288861148 2541 False 1132.000000 1875 96.459000 1 2468 3 chr1D.!!$F1 2467
5 TraesCS2B01G427400 chr2A 354529221 354531326 2105 False 1110.333333 1860 96.123333 1 2468 3 chr2A.!!$F1 2467
6 TraesCS2B01G427400 chr2A 494099486 494100998 1512 True 780.000000 1840 96.189333 1 1871 3 chr2A.!!$R2 1870
7 TraesCS2B01G427400 chr7D 61521385 61523923 2538 True 1109.333333 1812 95.630000 1 2468 3 chr7D.!!$R1 2467
8 TraesCS2B01G427400 chr7A 320507831 320509941 2110 False 1086.666667 1783 96.627333 1 2468 3 chr7A.!!$F1 2467
9 TraesCS2B01G427400 chr1A 408631463 408632661 1198 False 1777.000000 1777 93.583000 439 1626 1 chr1A.!!$F1 1187
10 TraesCS2B01G427400 chr4D 382846244 382847075 831 True 1376.000000 1376 96.514000 1637 2468 1 chr4D.!!$R1 831
11 TraesCS2B01G427400 chr6D 93876313 93877014 701 False 1035.000000 1035 93.457000 1775 2468 1 chr6D.!!$F1 693

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1039 1055 2.946947 GTGGAGGACACCAACATGG 58.053 57.895 0.0 0.0 44.49 3.66 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1930 2806 6.437928 TGAATCTAATTAAATCGCACCATGC 58.562 36.0 0.0 0.0 40.69 4.06 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1039 1055 2.946947 GTGGAGGACACCAACATGG 58.053 57.895 0.00 0.00 44.49 3.66
1131 1147 1.361668 GGAGCATCACGACGCACATT 61.362 55.000 0.00 0.00 36.25 2.71
1594 2464 5.393962 GCTGTTTTTGTTCTTCAGCGATAT 58.606 37.500 0.00 0.00 41.15 1.63
1614 2484 8.492748 GCGATATTTAACGATCTAAATGGTTCA 58.507 33.333 9.22 0.00 35.67 3.18
1622 2492 5.647658 ACGATCTAAATGGTTCAGCATTCAA 59.352 36.000 4.75 0.00 0.00 2.69
1765 2641 5.067413 TGCGTTTGGTACTTGGAAATAACAA 59.933 36.000 0.00 0.00 0.00 2.83
1930 2806 1.665679 GCCTTGGTGATATGACACGTG 59.334 52.381 15.48 15.48 41.12 4.49
2044 2920 5.359576 AGCACACTTGTTCACATAAAGGAAA 59.640 36.000 0.00 0.00 0.00 3.13
2278 3160 8.849168 TCTTTAGTTTTCTGATGATTGCTCAAA 58.151 29.630 0.00 0.00 34.37 2.69
2387 3269 9.448438 TTGCTCTGCTTGATAATTCTTTTACTA 57.552 29.630 0.00 0.00 0.00 1.82
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
733 745 1.797211 GAGATAGCTACTGCCGGCGT 61.797 60.000 23.90 23.67 40.80 5.68
743 755 0.321741 CGCCGGAGAGGAGATAGCTA 60.322 60.000 5.05 0.00 43.02 3.32
972 987 2.142357 CTCGAGTGGACGAACAGCCA 62.142 60.000 3.62 0.00 41.67 4.75
1039 1055 2.789917 CAGCTGCATCTTGGTCGC 59.210 61.111 0.00 0.00 0.00 5.19
1131 1147 4.431416 TGGCAAGTTTCTCACCTTCTTA 57.569 40.909 0.00 0.00 0.00 2.10
1594 2464 7.624360 ATGCTGAACCATTTAGATCGTTAAA 57.376 32.000 0.00 0.00 0.00 1.52
1614 2484 7.549134 TCAGATCGTTAACTATTGTTGAATGCT 59.451 33.333 3.71 0.00 37.59 3.79
1930 2806 6.437928 TGAATCTAATTAAATCGCACCATGC 58.562 36.000 0.00 0.00 40.69 4.06


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.