Multiple sequence alignment - TraesCS2B01G427300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G427300 chr2B 100.000 3447 0 0 2008 5454 614334171 614330725 0.000000e+00 6366.0
1 TraesCS2B01G427300 chr2B 100.000 3447 0 0 2008 5454 614437578 614434132 0.000000e+00 6366.0
2 TraesCS2B01G427300 chr2B 100.000 1796 0 0 1 1796 614439585 614437790 0.000000e+00 3317.0
3 TraesCS2B01G427300 chr2B 99.902 1024 1 0 773 1796 614335536 614334513 0.000000e+00 1886.0
4 TraesCS2B01G427300 chr2B 98.708 774 7 3 1 772 148043714 148044486 0.000000e+00 1371.0
5 TraesCS2B01G427300 chr2B 100.000 684 0 0 5500 6183 614434086 614433403 0.000000e+00 1264.0
6 TraesCS2B01G427300 chr2B 99.708 684 2 0 5500 6183 614330714 614330031 0.000000e+00 1253.0
7 TraesCS2B01G427300 chr2B 89.041 73 8 0 4343 4415 52221531 52221603 2.370000e-14 91.6
8 TraesCS2B01G427300 chr2B 79.845 129 22 3 4343 4468 52514169 52514042 2.370000e-14 91.6
9 TraesCS2B01G427300 chr2D 91.417 1538 109 14 2008 3537 521529161 521530683 0.000000e+00 2087.0
10 TraesCS2B01G427300 chr2D 90.265 1284 80 24 4140 5392 521531375 521532644 0.000000e+00 1637.0
11 TraesCS2B01G427300 chr2D 93.078 939 35 7 870 1796 521528239 521529159 0.000000e+00 1347.0
12 TraesCS2B01G427300 chr2D 89.417 652 42 14 3537 4171 521530725 521531366 0.000000e+00 797.0
13 TraesCS2B01G427300 chr2D 86.356 623 31 15 5597 6183 521532916 521533520 1.130000e-176 630.0
14 TraesCS2B01G427300 chr2D 88.983 118 12 1 4341 4457 90523642 90523759 1.800000e-30 145.0
15 TraesCS2B01G427300 chr2A 90.334 1376 85 11 4001 5339 666028660 666027296 0.000000e+00 1760.0
16 TraesCS2B01G427300 chr2A 93.382 967 41 8 850 1796 666031501 666030538 0.000000e+00 1410.0
17 TraesCS2B01G427300 chr2A 92.086 556 32 6 2491 3045 666029878 666029334 0.000000e+00 773.0
18 TraesCS2B01G427300 chr2A 92.545 389 24 5 2008 2393 666030536 666030150 2.520000e-153 553.0
19 TraesCS2B01G427300 chr2A 85.035 568 32 15 5623 6183 666027043 666026522 4.240000e-146 529.0
20 TraesCS2B01G427300 chr2A 90.030 331 20 5 3537 3857 666028988 666028661 3.450000e-112 416.0
21 TraesCS2B01G427300 chr2A 83.729 295 20 10 3243 3537 666029295 666029029 2.860000e-63 254.0
22 TraesCS2B01G427300 chr2A 92.105 114 9 0 2379 2492 666030072 666029959 1.780000e-35 161.0
23 TraesCS2B01G427300 chr5A 98.968 775 4 4 1 772 40927222 40927995 0.000000e+00 1384.0
24 TraesCS2B01G427300 chr3A 98.842 777 5 4 1 774 663791956 663792731 0.000000e+00 1382.0
25 TraesCS2B01G427300 chr4B 98.713 777 6 4 1 774 463080369 463079594 0.000000e+00 1376.0
26 TraesCS2B01G427300 chr4B 100.000 45 0 0 5410 5454 472138192 472138148 3.970000e-12 84.2
27 TraesCS2B01G427300 chr1B 92.535 777 49 8 3 774 570573599 570574371 0.000000e+00 1105.0
28 TraesCS2B01G427300 chr1B 97.674 43 0 1 5413 5454 312916471 312916513 8.600000e-09 73.1
29 TraesCS2B01G427300 chr1A 92.446 781 47 11 3 774 584410789 584410012 0.000000e+00 1105.0
30 TraesCS2B01G427300 chr1A 91.377 777 58 9 3 773 335036663 335037436 0.000000e+00 1055.0
31 TraesCS2B01G427300 chr7A 91.047 726 54 8 51 772 724256388 724257106 0.000000e+00 970.0
32 TraesCS2B01G427300 chr7A 82.482 137 20 3 4343 4476 728533044 728532909 3.920000e-22 117.0
33 TraesCS2B01G427300 chr6A 90.672 729 55 11 51 774 9514767 9515487 0.000000e+00 957.0
34 TraesCS2B01G427300 chr6A 85.321 109 13 3 4343 4449 26562679 26562572 6.550000e-20 110.0
35 TraesCS2B01G427300 chr6B 88.889 117 9 4 4343 4457 228234027 228233913 2.320000e-29 141.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G427300 chr2B 614433403 614439585 6182 True 3649.000000 6366 100.00000 1 6183 3 chr2B.!!$R3 6182
1 TraesCS2B01G427300 chr2B 614330031 614335536 5505 True 3168.333333 6366 99.87000 773 6183 3 chr2B.!!$R2 5410
2 TraesCS2B01G427300 chr2B 148043714 148044486 772 False 1371.000000 1371 98.70800 1 772 1 chr2B.!!$F2 771
3 TraesCS2B01G427300 chr2D 521528239 521533520 5281 False 1299.600000 2087 90.10660 870 6183 5 chr2D.!!$F2 5313
4 TraesCS2B01G427300 chr2A 666026522 666031501 4979 True 732.000000 1760 89.90575 850 6183 8 chr2A.!!$R1 5333
5 TraesCS2B01G427300 chr5A 40927222 40927995 773 False 1384.000000 1384 98.96800 1 772 1 chr5A.!!$F1 771
6 TraesCS2B01G427300 chr3A 663791956 663792731 775 False 1382.000000 1382 98.84200 1 774 1 chr3A.!!$F1 773
7 TraesCS2B01G427300 chr4B 463079594 463080369 775 True 1376.000000 1376 98.71300 1 774 1 chr4B.!!$R1 773
8 TraesCS2B01G427300 chr1B 570573599 570574371 772 False 1105.000000 1105 92.53500 3 774 1 chr1B.!!$F2 771
9 TraesCS2B01G427300 chr1A 584410012 584410789 777 True 1105.000000 1105 92.44600 3 774 1 chr1A.!!$R1 771
10 TraesCS2B01G427300 chr1A 335036663 335037436 773 False 1055.000000 1055 91.37700 3 773 1 chr1A.!!$F1 770
11 TraesCS2B01G427300 chr7A 724256388 724257106 718 False 970.000000 970 91.04700 51 772 1 chr7A.!!$F1 721
12 TraesCS2B01G427300 chr6A 9514767 9515487 720 False 957.000000 957 90.67200 51 774 1 chr6A.!!$F1 723

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
482 492 2.035321 GGAACCGGCATTTTTCACTTCA 59.965 45.455 0.0 0.0 0.0 3.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
5855 6559 3.381983 AGCACGACCGGCTCATCA 61.382 61.111 0.0 0.0 36.81 3.07 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
190 195 6.939730 TGCTACATACATCTTCTGTTTTTCCA 59.060 34.615 0.00 0.0 39.39 3.53
482 492 2.035321 GGAACCGGCATTTTTCACTTCA 59.965 45.455 0.00 0.0 0.00 3.02
508 518 2.351276 GATGAAGGCGGGTGGTGT 59.649 61.111 0.00 0.0 0.00 4.16
873 890 4.131649 CGGTTATTATGCCGGATGGATA 57.868 45.455 5.05 0.0 43.85 2.59
5855 6559 5.048013 AGCGGATTCGAAGGAAAAGAAAAAT 60.048 36.000 3.35 0.0 39.00 1.82
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
200 207 8.442384 CCAGCAAAATCAAAATATGGTTGTAAC 58.558 33.333 0.0 0.0 31.02 2.50
201 208 8.370940 TCCAGCAAAATCAAAATATGGTTGTAA 58.629 29.630 0.0 0.0 31.02 2.41
482 492 2.125512 GCCTTCATCGCCGACACT 60.126 61.111 0.0 0.0 0.00 3.55
5855 6559 3.381983 AGCACGACCGGCTCATCA 61.382 61.111 0.0 0.0 36.81 3.07


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.