Multiple sequence alignment - TraesCS2B01G427100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G427100 chr2B 100.000 4176 0 0 2138 6313 614334171 614329996 0.000000e+00 7675.0
1 TraesCS2B01G427100 chr2B 100.000 3447 0 0 2138 5584 614437578 614434132 0.000000e+00 6366.0
2 TraesCS2B01G427100 chr2B 100.000 1796 0 0 1 1796 614336308 614334513 0.000000e+00 3317.0
3 TraesCS2B01G427100 chr2B 99.902 1024 1 0 773 1796 614438813 614437790 0.000000e+00 1886.0
4 TraesCS2B01G427100 chr2B 99.722 719 2 0 5595 6313 614434086 614433368 0.000000e+00 1317.0
5 TraesCS2B01G427100 chr2B 96.925 683 15 2 1 683 614447837 614447161 0.000000e+00 1140.0
6 TraesCS2B01G427100 chr2B 96.633 683 17 2 1 683 614343169 614342493 0.000000e+00 1129.0
7 TraesCS2B01G427100 chr2B 95.154 681 25 3 1 680 744528521 744527848 0.000000e+00 1068.0
8 TraesCS2B01G427100 chr2B 89.041 73 8 0 4473 4545 52221531 52221603 2.420000e-14 91.6
9 TraesCS2B01G427100 chr2B 79.845 129 22 3 4473 4598 52514169 52514042 2.420000e-14 91.6
10 TraesCS2B01G427100 chr2D 91.417 1538 109 14 2138 3667 521529161 521530683 0.000000e+00 2087.0
11 TraesCS2B01G427100 chr2D 90.265 1284 80 24 4270 5522 521531375 521532644 0.000000e+00 1637.0
12 TraesCS2B01G427100 chr2D 93.184 939 34 7 870 1796 521528239 521529159 0.000000e+00 1352.0
13 TraesCS2B01G427100 chr2D 89.417 652 42 14 3667 4301 521530725 521531366 0.000000e+00 797.0
14 TraesCS2B01G427100 chr2D 86.910 657 32 16 5692 6312 521532916 521533554 0.000000e+00 688.0
15 TraesCS2B01G427100 chr2D 88.983 118 12 1 4471 4587 90523642 90523759 1.830000e-30 145.0
16 TraesCS2B01G427100 chr2A 90.334 1376 85 11 4131 5469 666028660 666027296 0.000000e+00 1760.0
17 TraesCS2B01G427100 chr2A 89.956 1135 67 22 705 1796 666031668 666030538 0.000000e+00 1421.0
18 TraesCS2B01G427100 chr2A 92.086 556 32 6 2621 3175 666029878 666029334 0.000000e+00 773.0
19 TraesCS2B01G427100 chr2A 85.880 602 32 15 5718 6312 666027043 666026488 5.450000e-165 592.0
20 TraesCS2B01G427100 chr2A 92.545 389 24 5 2138 2523 666030536 666030150 2.570000e-153 553.0
21 TraesCS2B01G427100 chr2A 90.030 331 20 5 3667 3987 666028988 666028661 3.520000e-112 416.0
22 TraesCS2B01G427100 chr2A 83.729 295 20 10 3373 3667 666029295 666029029 2.920000e-63 254.0
23 TraesCS2B01G427100 chr2A 92.105 114 9 0 2509 2622 666030072 666029959 1.820000e-35 161.0
24 TraesCS2B01G427100 chr1B 95.175 684 27 2 1 683 586156746 586156068 0.000000e+00 1075.0
25 TraesCS2B01G427100 chr1B 97.674 43 0 1 5543 5584 312916471 312916513 8.780000e-09 73.1
26 TraesCS2B01G427100 chr6B 95.029 684 31 2 1 683 522087220 522086539 0.000000e+00 1072.0
27 TraesCS2B01G427100 chr6B 94.876 683 29 3 1 682 131750253 131749576 0.000000e+00 1062.0
28 TraesCS2B01G427100 chr6B 88.889 117 9 4 4473 4587 228234027 228233913 2.370000e-29 141.0
29 TraesCS2B01G427100 chr7B 95.287 679 25 4 1 678 459805138 459804466 0.000000e+00 1070.0
30 TraesCS2B01G427100 chr7B 80.714 140 24 3 681 818 234017282 234017144 8.660000e-19 106.0
31 TraesCS2B01G427100 chr4B 95.280 678 27 1 1 678 172006641 172007313 0.000000e+00 1070.0
32 TraesCS2B01G427100 chr4B 100.000 45 0 0 5540 5584 472138192 472138148 4.060000e-12 84.2
33 TraesCS2B01G427100 chr5B 95.140 679 29 2 1 678 660007712 660008387 0.000000e+00 1068.0
34 TraesCS2B01G427100 chr7A 82.482 137 20 3 4473 4606 728533044 728532909 4.000000e-22 117.0
35 TraesCS2B01G427100 chr6A 85.321 109 13 3 4473 4579 26562679 26562572 6.690000e-20 110.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G427100 chr2B 614329996 614336308 6312 True 5496.000000 7675 100.000000 1 6313 2 chr2B.!!$R5 6312
1 TraesCS2B01G427100 chr2B 614433368 614438813 5445 True 3189.666667 6366 99.874667 773 6313 3 chr2B.!!$R6 5540
2 TraesCS2B01G427100 chr2B 614447161 614447837 676 True 1140.000000 1140 96.925000 1 683 1 chr2B.!!$R3 682
3 TraesCS2B01G427100 chr2B 614342493 614343169 676 True 1129.000000 1129 96.633000 1 683 1 chr2B.!!$R2 682
4 TraesCS2B01G427100 chr2B 744527848 744528521 673 True 1068.000000 1068 95.154000 1 680 1 chr2B.!!$R4 679
5 TraesCS2B01G427100 chr2D 521528239 521533554 5315 False 1312.200000 2087 90.238600 870 6312 5 chr2D.!!$F2 5442
6 TraesCS2B01G427100 chr2A 666026488 666031668 5180 True 741.250000 1760 89.583125 705 6312 8 chr2A.!!$R1 5607
7 TraesCS2B01G427100 chr1B 586156068 586156746 678 True 1075.000000 1075 95.175000 1 683 1 chr1B.!!$R1 682
8 TraesCS2B01G427100 chr6B 522086539 522087220 681 True 1072.000000 1072 95.029000 1 683 1 chr6B.!!$R3 682
9 TraesCS2B01G427100 chr6B 131749576 131750253 677 True 1062.000000 1062 94.876000 1 682 1 chr6B.!!$R1 681
10 TraesCS2B01G427100 chr7B 459804466 459805138 672 True 1070.000000 1070 95.287000 1 678 1 chr7B.!!$R2 677
11 TraesCS2B01G427100 chr4B 172006641 172007313 672 False 1070.000000 1070 95.280000 1 678 1 chr4B.!!$F1 677
12 TraesCS2B01G427100 chr5B 660007712 660008387 675 False 1068.000000 1068 95.140000 1 678 1 chr5B.!!$F1 677

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
249 252 0.251073 CCTTTATATACGGGGGCGGG 59.749 60.0 0.0 0.0 0.0 6.13 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
5847 6495 7.5806 ACGGAATTAACAAAATTGAAATTGGC 58.419 30.769 12.51 0.0 32.07 4.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
249 252 0.251073 CCTTTATATACGGGGGCGGG 59.749 60.000 0.00 0.00 0.00 6.13
250 253 1.269012 CTTTATATACGGGGGCGGGA 58.731 55.000 0.00 0.00 0.00 5.14
388 391 2.138320 CTGCGCCGATAGAACATCATT 58.862 47.619 4.18 0.00 39.76 2.57
567 570 1.665679 CGCGTTGTCATAATGCTTCCT 59.334 47.619 0.00 0.00 0.00 3.36
684 688 3.365265 GTTCCCCAACAGCGGCTG 61.365 66.667 27.43 27.43 37.52 4.85
727 731 3.733960 GGGCGGAAGTTGGTTCGC 61.734 66.667 0.00 0.00 35.80 4.70
771 775 5.689819 CAAAAACAAGGGTGAATCTCGTAG 58.310 41.667 0.00 0.00 0.00 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
81 82 1.616628 GAGAGGGAAAGAGGGGCCA 60.617 63.158 4.39 0.0 0.00 5.36
567 570 3.118261 ACATACCCTCGTAGACCGTAAGA 60.118 47.826 0.00 0.0 43.02 2.10
691 695 4.468689 CTTCCGTTCCCGCCTCCC 62.469 72.222 0.00 0.0 0.00 4.30
704 708 3.431725 CAACTTCCGCCCGCTTCC 61.432 66.667 0.00 0.0 0.00 3.46
705 709 3.431725 CCAACTTCCGCCCGCTTC 61.432 66.667 0.00 0.0 0.00 3.86
706 710 3.785122 AACCAACTTCCGCCCGCTT 62.785 57.895 0.00 0.0 0.00 4.68
707 711 4.265056 AACCAACTTCCGCCCGCT 62.265 61.111 0.00 0.0 0.00 5.52
708 712 3.733960 GAACCAACTTCCGCCCGC 61.734 66.667 0.00 0.0 0.00 6.13
709 713 3.419759 CGAACCAACTTCCGCCCG 61.420 66.667 0.00 0.0 0.00 6.13
710 714 3.733960 GCGAACCAACTTCCGCCC 61.734 66.667 0.00 0.0 0.00 6.13
711 715 4.084888 CGCGAACCAACTTCCGCC 62.085 66.667 0.00 0.0 0.00 6.13
712 716 4.736631 GCGCGAACCAACTTCCGC 62.737 66.667 12.10 0.0 39.63 5.54
715 719 1.082104 CTTGGCGCGAACCAACTTC 60.082 57.895 12.10 0.0 44.80 3.01
727 731 1.885887 CTAGATCCTCTCTCCTTGGCG 59.114 57.143 0.00 0.0 35.28 5.69
745 749 4.215399 CGAGATTCACCCTTGTTTTTGCTA 59.785 41.667 0.00 0.0 0.00 3.49
746 750 3.004734 CGAGATTCACCCTTGTTTTTGCT 59.995 43.478 0.00 0.0 0.00 3.91
747 751 3.243401 ACGAGATTCACCCTTGTTTTTGC 60.243 43.478 0.00 0.0 0.00 3.68
771 775 1.133869 CCGGATCGTTTTCGCCAAC 59.866 57.895 0.00 0.0 43.73 3.77
5847 6495 7.580600 ACGGAATTAACAAAATTGAAATTGGC 58.419 30.769 12.51 0.0 32.07 4.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.