Multiple sequence alignment - TraesCS2B01G423000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G423000 chr2B 100.000 2663 0 0 1 2663 608457624 608460286 0 4918
1 TraesCS2B01G423000 chr2B 98.799 2664 29 3 2 2663 99567815 99565153 0 4739
2 TraesCS2B01G423000 chr2A 99.025 2666 23 3 1 2663 389206954 389209619 0 4776
3 TraesCS2B01G423000 chr5A 98.911 2663 28 1 1 2663 294236753 294234092 0 4756
4 TraesCS2B01G423000 chr5A 98.909 2659 27 2 6 2663 17467852 17465195 0 4748
5 TraesCS2B01G423000 chr7B 98.874 2664 29 1 1 2663 194130141 194127478 0 4752
6 TraesCS2B01G423000 chr6A 98.874 2664 27 3 1 2663 87943545 87940884 0 4750
7 TraesCS2B01G423000 chr6A 98.724 2664 32 2 1 2663 12690992 12693654 0 4730
8 TraesCS2B01G423000 chr6A 98.724 2664 32 2 1 2663 480640271 480637609 0 4730
9 TraesCS2B01G423000 chr1A 98.837 2666 28 3 1 2663 255473996 255471331 0 4748


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G423000 chr2B 608457624 608460286 2662 False 4918 4918 100.000 1 2663 1 chr2B.!!$F1 2662
1 TraesCS2B01G423000 chr2B 99565153 99567815 2662 True 4739 4739 98.799 2 2663 1 chr2B.!!$R1 2661
2 TraesCS2B01G423000 chr2A 389206954 389209619 2665 False 4776 4776 99.025 1 2663 1 chr2A.!!$F1 2662
3 TraesCS2B01G423000 chr5A 294234092 294236753 2661 True 4756 4756 98.911 1 2663 1 chr5A.!!$R2 2662
4 TraesCS2B01G423000 chr5A 17465195 17467852 2657 True 4748 4748 98.909 6 2663 1 chr5A.!!$R1 2657
5 TraesCS2B01G423000 chr7B 194127478 194130141 2663 True 4752 4752 98.874 1 2663 1 chr7B.!!$R1 2662
6 TraesCS2B01G423000 chr6A 87940884 87943545 2661 True 4750 4750 98.874 1 2663 1 chr6A.!!$R1 2662
7 TraesCS2B01G423000 chr6A 12690992 12693654 2662 False 4730 4730 98.724 1 2663 1 chr6A.!!$F1 2662
8 TraesCS2B01G423000 chr6A 480637609 480640271 2662 True 4730 4730 98.724 1 2663 1 chr6A.!!$R2 2662
9 TraesCS2B01G423000 chr1A 255471331 255473996 2665 True 4748 4748 98.837 1 2663 1 chr1A.!!$R1 2662

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
923 925 0.248289 GCACCGAACAGGCTACCTAA 59.752 55.0 0.0 0.0 46.52 2.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2629 2640 1.512926 GACGCTGGACAACATTGAGT 58.487 50.0 0.0 0.0 0.0 3.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
298 299 4.494091 TCAAAGAAGCAGATAAGGGAGG 57.506 45.455 0.00 0.0 0.00 4.30
923 925 0.248289 GCACCGAACAGGCTACCTAA 59.752 55.000 0.00 0.0 46.52 2.69
1042 1045 4.796495 CCCGCCAGGCCCAACTAC 62.796 72.222 5.63 0.0 35.76 2.73
1607 1611 6.038492 CACCCAAAGAAGAAAAACAAATGCAT 59.962 34.615 0.00 0.0 0.00 3.96
2302 2311 3.807622 GTGCAACTGCTTGTGTTCTACTA 59.192 43.478 2.95 0.0 42.66 1.82
2629 2640 2.037902 TGGTAGAGGCGTTGTTCATCAA 59.962 45.455 0.00 0.0 0.00 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
298 299 7.504924 TCCAAAAATCGTATATCATGTTCCC 57.495 36.000 0.00 0.0 0.00 3.97
923 925 1.167851 ACTAACACAGCATGCGCAAT 58.832 45.000 17.11 0.0 42.53 3.56
1042 1045 0.250901 AGTAGCACAAAGGGCACTGG 60.251 55.000 0.00 0.0 0.00 4.00
1279 1282 0.249120 CGGCCTGTCATGGTACTTGA 59.751 55.000 0.00 0.0 0.00 3.02
1607 1611 1.208052 GCTCTGTAGATTGGCACTGGA 59.792 52.381 0.00 0.0 0.00 3.86
1816 1821 4.370917 CAACAAAGGCACAAATAGCAACT 58.629 39.130 0.00 0.0 0.00 3.16
2302 2311 4.559300 GCAAAGTGGCACATAATGAGTTGT 60.559 41.667 21.41 0.0 44.52 3.32
2629 2640 1.512926 GACGCTGGACAACATTGAGT 58.487 50.000 0.00 0.0 0.00 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.