Multiple sequence alignment - TraesCS2B01G405700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G405700 chr2B 100.000 2894 0 0 1 2894 573973813 573976706 0.000000e+00 5345.0
1 TraesCS2B01G405700 chr2B 99.257 1481 7 3 1416 2894 573985068 573986546 0.000000e+00 2671.0
2 TraesCS2B01G405700 chr2B 99.821 1118 2 0 1 1118 573938158 573939275 0.000000e+00 2054.0
3 TraesCS2B01G405700 chr2B 85.870 1189 108 31 712 1878 208212123 208210973 0.000000e+00 1210.0
4 TraesCS2B01G405700 chr2B 82.645 242 21 9 2227 2461 208210926 208210699 8.180000e-46 195.0
5 TraesCS2B01G405700 chr2B 97.674 86 2 0 2459 2544 573976356 573976271 6.460000e-32 148.0
6 TraesCS2B01G405700 chr2B 95.402 87 3 1 2459 2544 573986196 573986110 1.400000e-28 137.0
7 TraesCS2B01G405700 chrUn 91.580 1817 84 25 662 2461 13023148 13024912 0.000000e+00 2444.0
8 TraesCS2B01G405700 chrUn 87.556 675 54 11 1 654 13022426 13023091 0.000000e+00 754.0
9 TraesCS2B01G405700 chrUn 100.000 386 0 0 245 630 480628628 480628243 0.000000e+00 713.0
10 TraesCS2B01G405700 chrUn 93.902 246 13 2 2542 2785 13024911 13025156 1.270000e-98 370.0
11 TraesCS2B01G405700 chrUn 97.222 108 3 0 2784 2891 13025186 13025293 1.770000e-42 183.0
12 TraesCS2B01G405700 chr2D 91.967 971 36 18 1106 2069 490117826 490118761 0.000000e+00 1323.0
13 TraesCS2B01G405700 chr2D 85.679 1201 109 30 712 1878 148856696 148855525 0.000000e+00 1206.0
14 TraesCS2B01G405700 chr2D 93.766 401 14 9 669 1064 490117091 490117485 2.480000e-165 592.0
15 TraesCS2B01G405700 chr2D 91.743 327 19 5 2136 2461 490118756 490119075 5.690000e-122 448.0
16 TraesCS2B01G405700 chr2D 91.093 247 15 5 2542 2785 490119074 490119316 7.730000e-86 327.0
17 TraesCS2B01G405700 chr2D 81.780 236 36 7 1990 2222 381089569 381089338 1.060000e-44 191.0
18 TraesCS2B01G405700 chr2D 97.297 111 3 0 2784 2894 490119347 490119457 3.810000e-44 189.0
19 TraesCS2B01G405700 chr2D 82.278 237 21 11 2227 2456 148855478 148855256 4.920000e-43 185.0
20 TraesCS2B01G405700 chr2A 87.568 917 93 11 977 1878 153452268 153453178 0.000000e+00 1042.0
21 TraesCS2B01G405700 chr2A 82.083 240 23 12 2227 2461 153453225 153453449 1.370000e-43 187.0
22 TraesCS2B01G405700 chr2A 79.518 249 18 15 712 940 153451540 153451775 2.320000e-31 147.0
23 TraesCS2B01G405700 chr2A 87.755 98 11 1 2455 2551 5456872 5456775 2.360000e-21 113.0
24 TraesCS2B01G405700 chr4A 80.156 257 42 8 1298 1549 34027499 34027247 1.770000e-42 183.0
25 TraesCS2B01G405700 chr4A 90.217 92 8 1 2457 2547 697983074 697982983 5.070000e-23 119.0
26 TraesCS2B01G405700 chr5D 79.681 251 48 3 1958 2207 510468273 510468521 8.240000e-41 178.0
27 TraesCS2B01G405700 chr7B 76.923 260 55 5 1949 2207 189907200 189907455 3.010000e-30 143.0
28 TraesCS2B01G405700 chr7B 87.000 100 11 2 2452 2550 15307976 15307878 8.480000e-21 111.0
29 TraesCS2B01G405700 chr3B 75.969 258 55 6 1958 2214 306589128 306589379 3.030000e-25 126.0
30 TraesCS2B01G405700 chr3B 90.110 91 7 2 2455 2543 472309349 472309439 1.820000e-22 117.0
31 TraesCS2B01G405700 chr3B 86.408 103 12 2 2445 2546 123461006 123460905 8.480000e-21 111.0
32 TraesCS2B01G405700 chr4D 90.000 90 7 2 2459 2547 160826733 160826821 6.550000e-22 115.0
33 TraesCS2B01G405700 chr5B 81.897 116 19 2 1990 2104 14340307 14340193 2.370000e-16 97.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G405700 chr2B 573973813 573976706 2893 False 5345.000000 5345 100.000000 1 2894 1 chr2B.!!$F2 2893
1 TraesCS2B01G405700 chr2B 573985068 573986546 1478 False 2671.000000 2671 99.257000 1416 2894 1 chr2B.!!$F3 1478
2 TraesCS2B01G405700 chr2B 573938158 573939275 1117 False 2054.000000 2054 99.821000 1 1118 1 chr2B.!!$F1 1117
3 TraesCS2B01G405700 chr2B 208210699 208212123 1424 True 702.500000 1210 84.257500 712 2461 2 chr2B.!!$R3 1749
4 TraesCS2B01G405700 chrUn 13022426 13025293 2867 False 937.750000 2444 92.565000 1 2891 4 chrUn.!!$F1 2890
5 TraesCS2B01G405700 chr2D 148855256 148856696 1440 True 695.500000 1206 83.978500 712 2456 2 chr2D.!!$R2 1744
6 TraesCS2B01G405700 chr2D 490117091 490119457 2366 False 575.800000 1323 93.173200 669 2894 5 chr2D.!!$F1 2225
7 TraesCS2B01G405700 chr2A 153451540 153453449 1909 False 458.666667 1042 83.056333 712 2461 3 chr2A.!!$F1 1749

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1326 2195 2.580815 CTCACCGATGAGCAGGCA 59.419 61.111 0.0 0.0 45.83 4.75 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2849 3819 2.292828 AAAGCACCATGTAGCCAGTT 57.707 45.0 3.28 0.0 0.0 3.16 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1326 2195 2.580815 CTCACCGATGAGCAGGCA 59.419 61.111 0.00 0.00 45.83 4.75
1881 2781 1.214589 GATGTGCGTACCCGACTGT 59.785 57.895 0.00 0.00 35.63 3.55
1981 2896 0.742990 TCTCCCACAAAATAGGCGCG 60.743 55.000 0.00 0.00 0.00 6.86
1982 2897 1.003112 TCCCACAAAATAGGCGCGT 60.003 52.632 8.43 8.08 0.00 6.01
1983 2898 0.606944 TCCCACAAAATAGGCGCGTT 60.607 50.000 8.36 0.00 0.00 4.84
1984 2899 1.088306 CCCACAAAATAGGCGCGTTA 58.912 50.000 8.36 0.00 0.00 3.18
1985 2900 1.469308 CCCACAAAATAGGCGCGTTAA 59.531 47.619 8.36 0.00 0.00 2.01
1986 2901 2.098443 CCCACAAAATAGGCGCGTTAAT 59.902 45.455 8.36 0.00 0.00 1.40
1987 2902 3.428316 CCCACAAAATAGGCGCGTTAATT 60.428 43.478 8.36 0.00 0.00 1.40
1988 2903 3.545873 CCACAAAATAGGCGCGTTAATTG 59.454 43.478 8.36 13.02 0.00 2.32
1989 2904 3.001168 CACAAAATAGGCGCGTTAATTGC 60.001 43.478 8.36 0.00 0.00 3.56
2169 3088 2.499197 CGGTATAGCTGCTGAGAGAGA 58.501 52.381 13.43 0.00 0.00 3.10
2170 3089 2.483877 CGGTATAGCTGCTGAGAGAGAG 59.516 54.545 13.43 0.00 0.00 3.20
2185 3104 2.169352 GAGAGAGGCTGCCACTAAATCA 59.831 50.000 22.65 0.00 0.00 2.57
2192 3111 3.242870 GGCTGCCACTAAATCATTTCTCG 60.243 47.826 15.17 0.00 0.00 4.04
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1326 2195 0.688418 AGCTCAGCTCCAGCATCTCT 60.688 55.000 15.16 0.00 45.16 3.10
2169 3088 3.950395 GAGAAATGATTTAGTGGCAGCCT 59.050 43.478 14.15 0.00 0.00 4.58
2170 3089 3.242870 CGAGAAATGATTTAGTGGCAGCC 60.243 47.826 3.66 3.66 0.00 4.85
2185 3104 6.034898 CCAAAGATTAAAATTGCGCGAGAAAT 59.965 34.615 12.10 2.86 42.57 2.17
2192 3111 7.268235 GCTAAAAACCAAAGATTAAAATTGCGC 59.732 33.333 0.00 0.00 0.00 6.09
2849 3819 2.292828 AAAGCACCATGTAGCCAGTT 57.707 45.000 3.28 0.00 0.00 3.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.