Multiple sequence alignment - TraesCS2B01G399900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G399900 chr2B 100.000 3836 0 0 1 3836 568459239 568463074 0.000000e+00 7084
1 TraesCS2B01G399900 chr6B 99.135 2776 22 1 1 2776 433049299 433052072 0.000000e+00 4992
2 TraesCS2B01G399900 chr5B 99.135 2776 22 1 1 2776 461405956 461408729 0.000000e+00 4992
3 TraesCS2B01G399900 chr5B 98.875 1067 12 0 2770 3836 9531257 9530191 0.000000e+00 1905
4 TraesCS2B01G399900 chr4B 99.063 2776 24 1 1 2776 99013758 99010985 0.000000e+00 4981
5 TraesCS2B01G399900 chr5A 98.991 2776 26 1 1 2776 12034654 12037427 0.000000e+00 4970
6 TraesCS2B01G399900 chr5A 97.736 2783 47 6 1 2776 474928444 474925671 0.000000e+00 4776
7 TraesCS2B01G399900 chr1B 98.499 2798 19 9 1 2776 675387174 675384378 0.000000e+00 4913
8 TraesCS2B01G399900 chr1B 99.250 1066 8 0 2771 3836 675381525 675380460 0.000000e+00 1925
9 TraesCS2B01G399900 chr1B 98.875 1067 12 0 2770 3836 681073045 681074111 0.000000e+00 1905
10 TraesCS2B01G399900 chr7A 97.449 2783 57 6 1 2776 715832313 715829538 0.000000e+00 4734
11 TraesCS2B01G399900 chr7A 99.053 2639 15 2 147 2776 77420630 77423267 0.000000e+00 4726
12 TraesCS2B01G399900 chr7A 96.588 1055 36 0 2770 3824 441126652 441127706 0.000000e+00 1749
13 TraesCS2B01G399900 chr3A 97.025 2790 66 6 2 2776 42334438 42331651 0.000000e+00 4676
14 TraesCS2B01G399900 chr3A 99.250 1067 8 0 2770 3836 728508126 728507060 0.000000e+00 1927
15 TraesCS2B01G399900 chr3A 92.929 198 7 3 1 193 438220717 438220912 8.110000e-72 281
16 TraesCS2B01G399900 chr6A 99.250 1067 8 0 2770 3836 564385313 564384247 0.000000e+00 1927
17 TraesCS2B01G399900 chr2A 97.001 1067 32 0 2770 3836 755125605 755124539 0.000000e+00 1794
18 TraesCS2B01G399900 chr2A 97.001 1067 32 0 2770 3836 760353214 760352148 0.000000e+00 1794
19 TraesCS2B01G399900 chr7B 96.154 1066 38 2 2771 3836 619107734 619106672 0.000000e+00 1738


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G399900 chr2B 568459239 568463074 3835 False 7084 7084 100.0000 1 3836 1 chr2B.!!$F1 3835
1 TraesCS2B01G399900 chr6B 433049299 433052072 2773 False 4992 4992 99.1350 1 2776 1 chr6B.!!$F1 2775
2 TraesCS2B01G399900 chr5B 461405956 461408729 2773 False 4992 4992 99.1350 1 2776 1 chr5B.!!$F1 2775
3 TraesCS2B01G399900 chr5B 9530191 9531257 1066 True 1905 1905 98.8750 2770 3836 1 chr5B.!!$R1 1066
4 TraesCS2B01G399900 chr4B 99010985 99013758 2773 True 4981 4981 99.0630 1 2776 1 chr4B.!!$R1 2775
5 TraesCS2B01G399900 chr5A 12034654 12037427 2773 False 4970 4970 98.9910 1 2776 1 chr5A.!!$F1 2775
6 TraesCS2B01G399900 chr5A 474925671 474928444 2773 True 4776 4776 97.7360 1 2776 1 chr5A.!!$R1 2775
7 TraesCS2B01G399900 chr1B 675380460 675387174 6714 True 3419 4913 98.8745 1 3836 2 chr1B.!!$R1 3835
8 TraesCS2B01G399900 chr1B 681073045 681074111 1066 False 1905 1905 98.8750 2770 3836 1 chr1B.!!$F1 1066
9 TraesCS2B01G399900 chr7A 715829538 715832313 2775 True 4734 4734 97.4490 1 2776 1 chr7A.!!$R1 2775
10 TraesCS2B01G399900 chr7A 77420630 77423267 2637 False 4726 4726 99.0530 147 2776 1 chr7A.!!$F1 2629
11 TraesCS2B01G399900 chr7A 441126652 441127706 1054 False 1749 1749 96.5880 2770 3824 1 chr7A.!!$F2 1054
12 TraesCS2B01G399900 chr3A 42331651 42334438 2787 True 4676 4676 97.0250 2 2776 1 chr3A.!!$R1 2774
13 TraesCS2B01G399900 chr3A 728507060 728508126 1066 True 1927 1927 99.2500 2770 3836 1 chr3A.!!$R2 1066
14 TraesCS2B01G399900 chr6A 564384247 564385313 1066 True 1927 1927 99.2500 2770 3836 1 chr6A.!!$R1 1066
15 TraesCS2B01G399900 chr2A 755124539 755125605 1066 True 1794 1794 97.0010 2770 3836 1 chr2A.!!$R1 1066
16 TraesCS2B01G399900 chr2A 760352148 760353214 1066 True 1794 1794 97.0010 2770 3836 1 chr2A.!!$R2 1066
17 TraesCS2B01G399900 chr7B 619106672 619107734 1062 True 1738 1738 96.1540 2771 3836 1 chr7B.!!$R1 1065

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
512 563 0.388134 GGTGCAAGTACTTCGCGAGA 60.388 55.0 9.59 0.00 39.2 4.04 F
1175 1226 0.905357 AGTTTCGGTCTGGATCCTGG 59.095 55.0 17.73 8.65 0.0 4.45 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1781 1832 1.864711 CCCACTTTATCACCGCATACG 59.135 52.381 0.0 0.0 39.67 3.06 R
3344 6253 2.095768 CCGAAGTCCGTCTACACGTAAA 60.096 50.000 0.0 0.0 45.17 2.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
512 563 0.388134 GGTGCAAGTACTTCGCGAGA 60.388 55.000 9.59 0.00 39.20 4.04
1114 1165 2.426024 GTTATGACACTAGCTGACCCGA 59.574 50.000 0.00 0.00 0.00 5.14
1175 1226 0.905357 AGTTTCGGTCTGGATCCTGG 59.095 55.000 17.73 8.65 0.00 4.45
1535 1586 7.359598 CCAGTCGATAATATTAGCTGTTTCTGC 60.360 40.741 8.95 0.00 0.00 4.26
2261 2312 4.222810 ACACATGAGGTTGCTGAGTATACA 59.777 41.667 5.50 0.00 0.00 2.29
2954 5863 5.799827 CCTTTAACTGGGAAATGTTTGGA 57.200 39.130 0.00 0.00 0.00 3.53
3752 6661 3.259123 TCTTGCATTCTCAGCAGTCACTA 59.741 43.478 0.00 0.00 43.75 2.74
3765 6674 4.003648 GCAGTCACTAATGCTTACTGGTT 58.996 43.478 0.00 0.00 38.36 3.67
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1114 1165 5.070446 TCAACTGTCTAATGTCCAGTCTGTT 59.930 40.000 0.0 0.0 38.44 3.16
1175 1226 5.175856 GCATGAATACTGACGGAACATACTC 59.824 44.000 0.0 0.0 0.00 2.59
1535 1586 2.029623 CCTCATCCCCATCAGCAAAAG 58.970 52.381 0.0 0.0 0.00 2.27
1781 1832 1.864711 CCCACTTTATCACCGCATACG 59.135 52.381 0.0 0.0 39.67 3.06
3344 6253 2.095768 CCGAAGTCCGTCTACACGTAAA 60.096 50.000 0.0 0.0 45.17 2.01
3752 6661 2.226437 CGAAGCACAACCAGTAAGCATT 59.774 45.455 0.0 0.0 0.00 3.56
3765 6674 2.034432 ACAAATGCATGAACGAAGCACA 59.966 40.909 0.0 0.0 41.60 4.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.