Multiple sequence alignment - TraesCS2B01G397100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G397100 chr2B 100.000 2952 0 0 1 2952 563765201 563768152 0 5452
1 TraesCS2B01G397100 chr2B 98.679 2953 37 2 1 2951 106932256 106935208 0 5236
2 TraesCS2B01G397100 chr2B 98.578 2953 40 2 1 2952 257723680 257720729 0 5219
3 TraesCS2B01G397100 chr2B 98.510 2954 42 2 1 2952 327771546 327768593 0 5210
4 TraesCS2B01G397100 chr2B 98.375 2953 47 1 1 2952 63584120 63587072 0 5186
5 TraesCS2B01G397100 chr3B 98.747 2953 36 1 1 2952 717600214 717597262 0 5247
6 TraesCS2B01G397100 chr1B 98.679 2953 38 1 1 2952 26649547 26652499 0 5236
7 TraesCS2B01G397100 chr5B 98.578 2954 40 2 1 2952 36453513 36450560 0 5221
8 TraesCS2B01G397100 chr4B 98.544 2954 39 4 1 2952 11627593 11624642 0 5214
9 TraesCS2B01G397100 chr6B 98.340 2951 48 1 1 2950 586281871 586278921 0 5177


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G397100 chr2B 563765201 563768152 2951 False 5452 5452 100.000 1 2952 1 chr2B.!!$F3 2951
1 TraesCS2B01G397100 chr2B 106932256 106935208 2952 False 5236 5236 98.679 1 2951 1 chr2B.!!$F2 2950
2 TraesCS2B01G397100 chr2B 257720729 257723680 2951 True 5219 5219 98.578 1 2952 1 chr2B.!!$R1 2951
3 TraesCS2B01G397100 chr2B 327768593 327771546 2953 True 5210 5210 98.510 1 2952 1 chr2B.!!$R2 2951
4 TraesCS2B01G397100 chr2B 63584120 63587072 2952 False 5186 5186 98.375 1 2952 1 chr2B.!!$F1 2951
5 TraesCS2B01G397100 chr3B 717597262 717600214 2952 True 5247 5247 98.747 1 2952 1 chr3B.!!$R1 2951
6 TraesCS2B01G397100 chr1B 26649547 26652499 2952 False 5236 5236 98.679 1 2952 1 chr1B.!!$F1 2951
7 TraesCS2B01G397100 chr5B 36450560 36453513 2953 True 5221 5221 98.578 1 2952 1 chr5B.!!$R1 2951
8 TraesCS2B01G397100 chr4B 11624642 11627593 2951 True 5214 5214 98.544 1 2952 1 chr4B.!!$R1 2951
9 TraesCS2B01G397100 chr6B 586278921 586281871 2950 True 5177 5177 98.340 1 2950 1 chr6B.!!$R1 2949

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
863 864 0.905809 TTACCCAACGAGCAGCCCTA 60.906 55.0 0.0 0.0 0.0 3.53 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2660 2665 4.252878 TCAAGCAGTATTCAGATTCGCAA 58.747 39.13 0.0 0.0 0.0 4.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
308 309 1.180029 GATGAAGCCTGCACATGGTT 58.820 50.000 0.00 0.00 0.00 3.67
452 453 8.678199 TGTCTCATCATCTTAACTACTACAGTG 58.322 37.037 0.00 0.00 37.63 3.66
516 517 6.564709 GCATGTTTGCTAATCATCCATCTA 57.435 37.500 0.00 0.00 45.77 1.98
768 769 5.960811 TGGGTTCAATTCTTGGGCAATATAA 59.039 36.000 0.00 0.00 0.00 0.98
863 864 0.905809 TTACCCAACGAGCAGCCCTA 60.906 55.000 0.00 0.00 0.00 3.53
1248 1249 0.545787 TTGGGAACGGAAGGGAGCTA 60.546 55.000 0.00 0.00 0.00 3.32
1795 1798 5.296813 ACTTGTTTTCACTGTCACTTGAC 57.703 39.130 2.19 2.19 44.97 3.18
1891 1894 1.866237 GAGCGAACGGATGCAACAA 59.134 52.632 0.00 0.00 0.00 2.83
2028 2031 5.101529 TCCTTGGTTCCCTTTATTCTCTCT 58.898 41.667 0.00 0.00 0.00 3.10
2648 2653 8.726988 GGTTGCTCTTGTTTAAGTATTATGTGA 58.273 33.333 0.00 0.00 35.38 3.58
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
135 136 6.740944 TGAACAAGGCCTACTATAGCATAA 57.259 37.500 5.16 0.00 0.00 1.90
308 309 1.344438 ACTGTTGTTCCATCGAGCTCA 59.656 47.619 15.40 1.08 0.00 4.26
516 517 6.575411 AGGTAGGGATCATATAACATGAGGT 58.425 40.000 0.00 0.00 0.00 3.85
702 703 5.786311 CAATTCAACTCCATTGGTTGTCAT 58.214 37.500 1.86 0.00 42.97 3.06
768 769 2.288886 GCGTGAAGAGTGGAAACTACCT 60.289 50.000 0.00 0.00 0.00 3.08
863 864 3.069980 GCGAGATCCAGCGAGGTGT 62.070 63.158 4.64 0.00 39.02 4.16
1248 1249 2.969950 CCCCAGATTCAATGCATGGAAT 59.030 45.455 26.20 26.20 36.49 3.01
2028 2031 5.561919 CGCATACTAAACTTCACAAAGGCAA 60.562 40.000 0.00 0.00 36.78 4.52
2660 2665 4.252878 TCAAGCAGTATTCAGATTCGCAA 58.747 39.130 0.00 0.00 0.00 4.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.