Multiple sequence alignment - TraesCS2B01G379200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G379200 chr2B 100.000 2837 0 0 1 2837 542736943 542739779 0 5240
1 TraesCS2B01G379200 chr2B 98.696 2838 27 5 1 2837 542726250 542729078 0 5027
2 TraesCS2B01G379200 chr2B 98.273 2838 40 6 1 2837 791884165 791881336 0 4961
3 TraesCS2B01G379200 chr2B 98.062 2838 46 6 1 2837 791877747 791874918 0 4927
4 TraesCS2B01G379200 chr2B 97.957 2839 48 6 1 2837 791854107 791856937 0 4913
5 TraesCS2B01G379200 chr2B 97.820 2844 50 10 1 2837 791908652 791911490 0 4898
6 TraesCS2B01G379200 chr6A 98.274 2839 41 6 1 2837 531357173 531354341 0 4964
7 TraesCS2B01G379200 chr4A 98.273 2838 41 5 1 2837 59258886 59256056 0 4963
8 TraesCS2B01G379200 chr5A 98.240 2841 36 8 1 2837 21853807 21856637 0 4957
9 TraesCS2B01G379200 chr7B 98.101 2843 42 7 1 2837 368080841 368078005 0 4940


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G379200 chr2B 542736943 542739779 2836 False 5240 5240 100.0000 1 2837 1 chr2B.!!$F2 2836
1 TraesCS2B01G379200 chr2B 542726250 542729078 2828 False 5027 5027 98.6960 1 2837 1 chr2B.!!$F1 2836
2 TraesCS2B01G379200 chr2B 791874918 791884165 9247 True 4944 4961 98.1675 1 2837 2 chr2B.!!$R1 2836
3 TraesCS2B01G379200 chr2B 791854107 791856937 2830 False 4913 4913 97.9570 1 2837 1 chr2B.!!$F3 2836
4 TraesCS2B01G379200 chr2B 791908652 791911490 2838 False 4898 4898 97.8200 1 2837 1 chr2B.!!$F4 2836
5 TraesCS2B01G379200 chr6A 531354341 531357173 2832 True 4964 4964 98.2740 1 2837 1 chr6A.!!$R1 2836
6 TraesCS2B01G379200 chr4A 59256056 59258886 2830 True 4963 4963 98.2730 1 2837 1 chr4A.!!$R1 2836
7 TraesCS2B01G379200 chr5A 21853807 21856637 2830 False 4957 4957 98.2400 1 2837 1 chr5A.!!$F1 2836
8 TraesCS2B01G379200 chr7B 368078005 368080841 2836 True 4940 4940 98.1010 1 2837 1 chr7B.!!$R1 2836

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1880 8304 6.883756 TGATATTGCTATCAATTATTCGGGCA 59.116 34.615 0.0 0.0 40.58 5.36 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2743 9191 3.005472 GGCTACACAGAGAACTACACACA 59.995 47.826 0.0 0.0 0.0 3.72 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1880 8304 6.883756 TGATATTGCTATCAATTATTCGGGCA 59.116 34.615 0.00 0.00 40.58 5.36
1895 8319 1.045407 GGGCACGGAGGACATATACA 58.955 55.000 0.00 0.00 0.00 2.29
2175 8621 3.186001 GGCTAATCGCATGAAGATCTGTG 59.814 47.826 0.00 0.00 41.67 3.66
2188 8634 1.830587 ATCTGTGTGGCCGAAGAGCA 61.831 55.000 0.00 0.00 0.00 4.26
2234 8680 5.758296 GCCAATTATTCACCGAGAGACAATA 59.242 40.000 0.00 0.00 0.00 1.90
2235 8681 6.428159 GCCAATTATTCACCGAGAGACAATAT 59.572 38.462 0.00 0.00 0.00 1.28
2250 8696 4.327357 AGACAATATCACGTGAAGAAAGCG 59.673 41.667 24.13 9.88 0.00 4.68
2267 8713 5.584251 AGAAAGCGAAGATTCCTGAAGATTC 59.416 40.000 0.00 0.00 31.23 2.52
2351 8797 0.948623 GACACGTGTGCATGCTACCA 60.949 55.000 28.82 10.10 0.00 3.25
2455 8901 6.429692 TCAAGAAGAAAACAACACAAGAGACA 59.570 34.615 0.00 0.00 0.00 3.41
2465 8911 1.342496 CACAAGAGACAGGAGAGCACA 59.658 52.381 0.00 0.00 0.00 4.57
2602 9049 8.603304 AGGTAATTTCCTAGTTGTGTGTAATCT 58.397 33.333 1.04 0.00 35.87 2.40
2614 9061 2.037144 GTGTAATCTCTTCGGGGCCTA 58.963 52.381 0.84 0.00 0.00 3.93
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1880 8304 1.952296 GGTCGTGTATATGTCCTCCGT 59.048 52.381 0.00 0.00 0.00 4.69
1895 8319 6.649557 GGAATTTCTATCAATATTCGGGTCGT 59.350 38.462 0.00 0.00 0.00 4.34
2076 8522 2.867429 CCAAGGCTGCTTACATTTTCG 58.133 47.619 0.00 0.00 0.00 3.46
2175 8621 0.603975 AGTCTTTGCTCTTCGGCCAC 60.604 55.000 2.24 0.00 0.00 5.01
2188 8634 5.298347 GCTAGTCTTTGTGTACCAGTCTTT 58.702 41.667 0.00 0.00 0.00 2.52
2234 8680 3.026630 TCTTCGCTTTCTTCACGTGAT 57.973 42.857 20.80 0.00 0.00 3.06
2235 8681 2.502213 TCTTCGCTTTCTTCACGTGA 57.498 45.000 15.76 15.76 0.00 4.35
2250 8696 7.880105 ACAAGTTTGAATCTTCAGGAATCTTC 58.120 34.615 0.00 0.00 38.61 2.87
2267 8713 1.795286 GAGAGAGTGCCGACAAGTTTG 59.205 52.381 0.00 0.00 0.00 2.93
2351 8797 5.656859 GCCTTCCTTCACTTATTTTACCCAT 59.343 40.000 0.00 0.00 0.00 4.00
2455 8901 1.273759 TGAATGCTCTGTGCTCTCCT 58.726 50.000 3.20 0.00 43.37 3.69
2465 8911 2.935201 GTCTCGATGCTTTGAATGCTCT 59.065 45.455 4.67 0.00 0.00 4.09
2614 9061 4.042271 ACATATGGTTTTCCCTTTCGGT 57.958 40.909 7.80 0.00 39.73 4.69
2646 9093 9.696917 GAAACCAAGAAACTACATCATTTCAAT 57.303 29.630 0.00 0.00 37.30 2.57
2743 9191 3.005472 GGCTACACAGAGAACTACACACA 59.995 47.826 0.00 0.00 0.00 3.72


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.