Multiple sequence alignment - TraesCS2B01G365800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G365800 chr2B 100.000 2393 0 0 1 2393 521511786 521514178 0.000000e+00 4420.0
1 TraesCS2B01G365800 chr2B 89.281 737 57 13 1609 2330 560464510 560465239 0.000000e+00 904.0
2 TraesCS2B01G365800 chr2B 85.104 866 55 22 1564 2383 728369162 728368325 0.000000e+00 817.0
3 TraesCS2B01G365800 chr2A 98.800 2334 15 2 72 2393 654740419 654742751 0.000000e+00 4143.0
4 TraesCS2B01G365800 chr2A 96.107 2389 66 10 27 2393 166244686 166247069 0.000000e+00 3871.0
5 TraesCS2B01G365800 chr2A 88.955 842 57 17 252 1083 554018126 554017311 0.000000e+00 1007.0
6 TraesCS2B01G365800 chr7A 95.982 2414 70 10 2 2393 8457995 8460403 0.000000e+00 3895.0
7 TraesCS2B01G365800 chr7A 92.074 1022 32 17 98 1080 200006117 200007128 0.000000e+00 1393.0
8 TraesCS2B01G365800 chr7A 88.718 780 52 21 1564 2330 672983077 672983833 0.000000e+00 920.0
9 TraesCS2B01G365800 chr7A 89.189 555 33 10 1831 2383 232334804 232335333 0.000000e+00 667.0
10 TraesCS2B01G365800 chr7A 91.988 337 23 3 1081 1415 87694408 87694074 1.000000e-128 470.0
11 TraesCS2B01G365800 chr7A 86.667 285 10 7 1128 1412 563493030 563493286 8.370000e-75 291.0
12 TraesCS2B01G365800 chr5D 91.420 979 51 14 127 1083 34275346 34274379 0.000000e+00 1312.0
13 TraesCS2B01G365800 chr5D 92.517 147 11 0 1266 1412 230163636 230163782 6.700000e-51 211.0
14 TraesCS2B01G365800 chr5A 93.046 834 37 9 1564 2383 690941737 690940911 0.000000e+00 1199.0
15 TraesCS2B01G365800 chr5A 91.271 779 50 12 1564 2330 598352015 598351243 0.000000e+00 1046.0
16 TraesCS2B01G365800 chr5A 89.157 166 15 3 1409 1572 598352235 598352071 1.120000e-48 204.0
17 TraesCS2B01G365800 chr5A 87.500 168 19 1 918 1083 513254922 513254755 2.430000e-45 193.0
18 TraesCS2B01G365800 chr1A 92.206 834 43 12 1564 2383 518024226 518025051 0.000000e+00 1160.0
19 TraesCS2B01G365800 chr1A 89.157 166 15 3 1409 1572 144562818 144562654 1.120000e-48 204.0
20 TraesCS2B01G365800 chr1A 93.103 58 4 0 760 817 500983356 500983413 4.240000e-13 86.1
21 TraesCS2B01G365800 chr2D 90.338 859 36 24 246 1083 433215392 433216224 0.000000e+00 1083.0
22 TraesCS2B01G365800 chr1B 90.489 736 48 15 1609 2330 180410577 180409850 0.000000e+00 952.0
23 TraesCS2B01G365800 chr5B 90.353 736 48 14 1611 2330 13759890 13760618 0.000000e+00 944.0
24 TraesCS2B01G365800 chr6B 89.529 764 42 16 252 993 56991030 56990283 0.000000e+00 933.0
25 TraesCS2B01G365800 chr6A 88.832 779 53 15 1564 2330 422267150 422267906 0.000000e+00 926.0
26 TraesCS2B01G365800 chr6A 93.043 230 14 2 246 475 182495737 182495964 3.810000e-88 335.0
27 TraesCS2B01G365800 chr6A 89.157 166 14 4 1409 1572 422266930 422267093 1.120000e-48 204.0
28 TraesCS2B01G365800 chr7D 89.550 555 32 8 1831 2383 596080946 596080416 0.000000e+00 680.0
29 TraesCS2B01G365800 chr7D 91.843 331 16 2 1082 1412 162147220 162147539 3.630000e-123 451.0
30 TraesCS2B01G365800 chr3B 88.468 555 38 8 1831 2383 655669725 655669195 0.000000e+00 647.0
31 TraesCS2B01G365800 chr1D 94.925 335 14 1 1081 1415 34023881 34023550 2.730000e-144 521.0
32 TraesCS2B01G365800 chr4A 89.254 335 31 2 1081 1415 673473651 673473322 4.760000e-112 414.0
33 TraesCS2B01G365800 chr4A 88.889 162 14 1 926 1083 37972775 37972614 1.880000e-46 196.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G365800 chr2B 521511786 521514178 2392 False 4420 4420 100.0000 1 2393 1 chr2B.!!$F1 2392
1 TraesCS2B01G365800 chr2B 560464510 560465239 729 False 904 904 89.2810 1609 2330 1 chr2B.!!$F2 721
2 TraesCS2B01G365800 chr2B 728368325 728369162 837 True 817 817 85.1040 1564 2383 1 chr2B.!!$R1 819
3 TraesCS2B01G365800 chr2A 654740419 654742751 2332 False 4143 4143 98.8000 72 2393 1 chr2A.!!$F2 2321
4 TraesCS2B01G365800 chr2A 166244686 166247069 2383 False 3871 3871 96.1070 27 2393 1 chr2A.!!$F1 2366
5 TraesCS2B01G365800 chr2A 554017311 554018126 815 True 1007 1007 88.9550 252 1083 1 chr2A.!!$R1 831
6 TraesCS2B01G365800 chr7A 8457995 8460403 2408 False 3895 3895 95.9820 2 2393 1 chr7A.!!$F1 2391
7 TraesCS2B01G365800 chr7A 200006117 200007128 1011 False 1393 1393 92.0740 98 1080 1 chr7A.!!$F2 982
8 TraesCS2B01G365800 chr7A 672983077 672983833 756 False 920 920 88.7180 1564 2330 1 chr7A.!!$F5 766
9 TraesCS2B01G365800 chr7A 232334804 232335333 529 False 667 667 89.1890 1831 2383 1 chr7A.!!$F3 552
10 TraesCS2B01G365800 chr5D 34274379 34275346 967 True 1312 1312 91.4200 127 1083 1 chr5D.!!$R1 956
11 TraesCS2B01G365800 chr5A 690940911 690941737 826 True 1199 1199 93.0460 1564 2383 1 chr5A.!!$R2 819
12 TraesCS2B01G365800 chr5A 598351243 598352235 992 True 625 1046 90.2140 1409 2330 2 chr5A.!!$R3 921
13 TraesCS2B01G365800 chr1A 518024226 518025051 825 False 1160 1160 92.2060 1564 2383 1 chr1A.!!$F2 819
14 TraesCS2B01G365800 chr2D 433215392 433216224 832 False 1083 1083 90.3380 246 1083 1 chr2D.!!$F1 837
15 TraesCS2B01G365800 chr1B 180409850 180410577 727 True 952 952 90.4890 1609 2330 1 chr1B.!!$R1 721
16 TraesCS2B01G365800 chr5B 13759890 13760618 728 False 944 944 90.3530 1611 2330 1 chr5B.!!$F1 719
17 TraesCS2B01G365800 chr6B 56990283 56991030 747 True 933 933 89.5290 252 993 1 chr6B.!!$R1 741
18 TraesCS2B01G365800 chr6A 422266930 422267906 976 False 565 926 88.9945 1409 2330 2 chr6A.!!$F2 921
19 TraesCS2B01G365800 chr7D 596080416 596080946 530 True 680 680 89.5500 1831 2383 1 chr7D.!!$R1 552
20 TraesCS2B01G365800 chr3B 655669195 655669725 530 True 647 647 88.4680 1831 2383 1 chr3B.!!$R1 552

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
659 699 9.959749 CTGAATCCTAGACTTTCTCATAGTTAC 57.04 37.037 0.0 0.0 0.0 2.5 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2089 2245 6.720112 ATGGAAGTACAAGTTATACGCCTA 57.28 37.5 0.0 0.0 0.0 3.93 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
659 699 9.959749 CTGAATCCTAGACTTTCTCATAGTTAC 57.040 37.037 0.00 0.0 0.00 2.50
1106 1153 2.355363 CTTCGTCGTGGTCCGCAA 60.355 61.111 2.76 0.0 36.19 4.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
659 699 5.220662 CGATGGTTGCAGGTCTTATAAGTTG 60.221 44.0 12.19 10.21 0.0 3.16
2089 2245 6.720112 ATGGAAGTACAAGTTATACGCCTA 57.280 37.5 0.00 0.00 0.0 3.93


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.