Multiple sequence alignment - TraesCS2B01G331700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G331700 chr2B 100.000 2309 0 0 1 2309 474919477 474921785 0 4265
1 TraesCS2B01G331700 chr6D 98.528 2310 32 2 1 2309 389247275 389244967 0 4076
2 TraesCS2B01G331700 chr5D 98.442 2310 34 2 1 2309 503243819 503246127 0 4065
3 TraesCS2B01G331700 chr7B 98.398 2310 35 2 1 2309 663100878 663098570 0 4060
4 TraesCS2B01G331700 chr7B 98.182 2310 40 2 1 2309 662724951 662727259 0 4032
5 TraesCS2B01G331700 chr2A 98.355 2310 36 2 1 2309 726907908 726905600 0 4054
6 TraesCS2B01G331700 chr3A 98.312 2310 36 2 1 2309 66006585 66004278 0 4047
7 TraesCS2B01G331700 chr3A 97.662 2310 51 3 1 2309 695638935 695641242 0 3964
8 TraesCS2B01G331700 chr3B 98.225 2310 40 1 1 2309 201538068 201540377 0 4037
9 TraesCS2B01G331700 chr3D 98.225 2310 36 3 1 2309 589264976 589262671 0 4034


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G331700 chr2B 474919477 474921785 2308 False 4265 4265 100.000 1 2309 1 chr2B.!!$F1 2308
1 TraesCS2B01G331700 chr6D 389244967 389247275 2308 True 4076 4076 98.528 1 2309 1 chr6D.!!$R1 2308
2 TraesCS2B01G331700 chr5D 503243819 503246127 2308 False 4065 4065 98.442 1 2309 1 chr5D.!!$F1 2308
3 TraesCS2B01G331700 chr7B 663098570 663100878 2308 True 4060 4060 98.398 1 2309 1 chr7B.!!$R1 2308
4 TraesCS2B01G331700 chr7B 662724951 662727259 2308 False 4032 4032 98.182 1 2309 1 chr7B.!!$F1 2308
5 TraesCS2B01G331700 chr2A 726905600 726907908 2308 True 4054 4054 98.355 1 2309 1 chr2A.!!$R1 2308
6 TraesCS2B01G331700 chr3A 66004278 66006585 2307 True 4047 4047 98.312 1 2309 1 chr3A.!!$R1 2308
7 TraesCS2B01G331700 chr3A 695638935 695641242 2307 False 3964 3964 97.662 1 2309 1 chr3A.!!$F1 2308
8 TraesCS2B01G331700 chr3B 201538068 201540377 2309 False 4037 4037 98.225 1 2309 1 chr3B.!!$F1 2308
9 TraesCS2B01G331700 chr3D 589262671 589264976 2305 True 4034 4034 98.225 1 2309 1 chr3D.!!$R1 2308

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
368 369 0.039437 CGCTAGTAATCGCCGGTCAT 60.039 55.0 1.9 0.0 0.0 3.06 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2274 2276 0.335361 ACAGGGTCTATGGTCGGTCT 59.665 55.0 0.0 0.0 0.0 3.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
283 284 3.034878 CGATCTCGCGAGGGTGAT 58.965 61.111 33.98 21.13 31.08 3.06
368 369 0.039437 CGCTAGTAATCGCCGGTCAT 60.039 55.000 1.90 0.00 0.00 3.06
505 506 1.871080 CTTGCGACTGGAGTGAAGTT 58.129 50.000 0.00 0.00 0.00 2.66
663 664 7.020827 ACTTGGATATGGAAGTCTTCTTTCA 57.979 36.000 12.31 2.81 42.55 2.69
666 667 8.511604 TTGGATATGGAAGTCTTCTTTCATTC 57.488 34.615 12.31 7.73 44.78 2.67
800 801 3.198417 GCATGGGGATGTCAAAAGGAAAT 59.802 43.478 0.00 0.00 0.00 2.17
801 802 4.405358 GCATGGGGATGTCAAAAGGAAATA 59.595 41.667 0.00 0.00 0.00 1.40
1330 1331 3.714844 CGGAGGGATCGTACCATTCGAT 61.715 54.545 9.50 0.51 44.18 3.59
1380 1381 5.298777 GTCTGGAGAAAGCAGCAATCAATAT 59.701 40.000 0.00 0.00 0.00 1.28
1635 1636 1.742411 GCGTTCGGGAAGGATGAATCA 60.742 52.381 5.38 0.00 0.00 2.57
1672 1673 7.205515 AGTCTATTGATTCTCTCCCAATTGT 57.794 36.000 4.43 0.00 33.21 2.71
1920 1922 1.541310 TACCTGAACCGGTGGCTCAG 61.541 60.000 22.65 22.65 43.32 3.35
2095 2097 3.064412 TCTCCTAGGCTTCCCTCATCTA 58.936 50.000 2.96 0.00 41.75 1.98
2165 2167 3.682999 GCACTATCTCCCTTCAACCCTTC 60.683 52.174 0.00 0.00 0.00 3.46
2258 2260 4.974438 ACCCCAAGGACGCCCTCA 62.974 66.667 0.00 0.00 43.48 3.86
2274 2276 3.625897 CAGCGTCCAGGGGTCACA 61.626 66.667 0.00 0.00 0.00 3.58
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
191 192 2.763039 TGATGACTTGGCCTCATCCTA 58.237 47.619 23.63 9.32 42.35 2.94
283 284 2.707257 AGGACGGGTTTTTGGAGTTAGA 59.293 45.455 0.00 0.00 0.00 2.10
368 369 1.444250 GGATTCACCGCCGTATGGA 59.556 57.895 4.73 0.00 37.49 3.41
505 506 2.231964 CCAGTACGGCTACCTTGTTACA 59.768 50.000 0.00 0.00 0.00 2.41
663 664 4.807643 GCTTGGTCTTACTTCACCCTGAAT 60.808 45.833 0.00 0.00 35.59 2.57
666 667 2.039084 AGCTTGGTCTTACTTCACCCTG 59.961 50.000 0.00 0.00 0.00 4.45
800 801 5.181245 CCAAAAGCGAGAAAAACTCCATCTA 59.819 40.000 0.00 0.00 42.18 1.98
801 802 4.022849 CCAAAAGCGAGAAAAACTCCATCT 60.023 41.667 0.00 0.00 42.18 2.90
854 855 0.669077 CTGAGCTAATAGCCCGTCGT 59.331 55.000 8.88 0.00 43.77 4.34
1380 1381 3.780850 GGAAGGGAGGATTAGGAAAGTCA 59.219 47.826 0.00 0.00 0.00 3.41
1672 1673 4.037441 TCGCCCCTACGATCCAAA 57.963 55.556 0.00 0.00 37.09 3.28
1920 1922 7.120873 GTCCTCTTCCCCATTACTTAGAAAAAC 59.879 40.741 0.00 0.00 0.00 2.43
2095 2097 1.238896 TCCTCTTCCCCAGGGATCCT 61.239 60.000 12.58 0.00 44.74 3.24
2165 2167 2.415168 TCCTTTTGCTACATTTCGCTCG 59.585 45.455 0.00 0.00 0.00 5.03
2258 2260 3.314331 CTGTGACCCCTGGACGCT 61.314 66.667 0.00 0.00 0.00 5.07
2274 2276 0.335361 ACAGGGTCTATGGTCGGTCT 59.665 55.000 0.00 0.00 0.00 3.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.