Multiple sequence alignment - TraesCS2B01G331500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G331500 chr2B 100.000 2359 0 0 1 2359 474915895 474913537 0 4357
1 TraesCS2B01G331500 chr2B 98.603 2362 30 3 1 2359 449213741 449211380 0 4176
2 TraesCS2B01G331500 chr5D 98.899 2362 22 4 1 2359 503225673 503223313 0 4215
3 TraesCS2B01G331500 chr5D 98.308 2364 34 4 1 2359 503235989 503233627 0 4139
4 TraesCS2B01G331500 chr3A 98.772 2362 25 4 1 2359 66010168 66012528 0 4198
5 TraesCS2B01G331500 chr1A 98.603 2362 30 3 1 2359 278526785 278529146 0 4176


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G331500 chr2B 474913537 474915895 2358 True 4357 4357 100.000 1 2359 1 chr2B.!!$R2 2358
1 TraesCS2B01G331500 chr2B 449211380 449213741 2361 True 4176 4176 98.603 1 2359 1 chr2B.!!$R1 2358
2 TraesCS2B01G331500 chr5D 503223313 503225673 2360 True 4215 4215 98.899 1 2359 1 chr5D.!!$R1 2358
3 TraesCS2B01G331500 chr5D 503233627 503235989 2362 True 4139 4139 98.308 1 2359 1 chr5D.!!$R2 2358
4 TraesCS2B01G331500 chr3A 66010168 66012528 2360 False 4198 4198 98.772 1 2359 1 chr3A.!!$F1 2358
5 TraesCS2B01G331500 chr1A 278526785 278529146 2361 False 4176 4176 98.603 1 2359 1 chr1A.!!$F1 2358

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
578 582 0.596082 AAAGCGTCCGGGTCAAAATG 59.404 50.0 0.0 0.0 0.0 2.32 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2027 2034 4.30411 CATTGTATACGCCATTAGTCCGT 58.696 43.478 0.0 0.0 38.84 4.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
279 282 3.012518 AGAACTGCAAAATCCGATCCAG 58.987 45.455 0.00 0.0 0.00 3.86
390 394 6.200854 GCCGTGAAAAAGATTCAACAAAAGAT 59.799 34.615 0.00 0.0 0.00 2.40
537 541 1.074405 AGGAAGAGCACTTGCCATTCA 59.926 47.619 11.57 0.0 43.80 2.57
578 582 0.596082 AAAGCGTCCGGGTCAAAATG 59.404 50.000 0.00 0.0 0.00 2.32
598 602 8.829612 CAAAATGTGGCTTTCAAATTAAGTTCT 58.170 29.630 0.00 0.0 32.33 3.01
1449 1453 9.915629 TTTTTATGTGGTGCTAACGATTTAATT 57.084 25.926 0.00 0.0 0.00 1.40
1966 1973 2.827921 GCAGGGTCAGGAACAATGAATT 59.172 45.455 0.00 0.0 0.00 2.17
2027 2034 4.961438 ACGGGTAGTTCCTACAAAGAAA 57.039 40.909 4.01 0.0 38.58 2.52
2038 2045 5.484715 TCCTACAAAGAAACGGACTAATGG 58.515 41.667 0.00 0.0 0.00 3.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
537 541 7.633553 GCTTTTGGGATGCTTCTAATAACCAAT 60.634 37.037 0.0 0.0 36.71 3.16
578 582 8.593492 AATTCAGAACTTAATTTGAAAGCCAC 57.407 30.769 0.0 0.0 33.71 5.01
598 602 4.883585 CCTTTGGCAGCATCTACTAATTCA 59.116 41.667 0.0 0.0 0.00 2.57
1449 1453 7.661536 ACATTCTGGAGCTACAAAGATAGTA 57.338 36.000 0.0 0.0 0.00 1.82
2027 2034 4.304110 CATTGTATACGCCATTAGTCCGT 58.696 43.478 0.0 0.0 38.84 4.69
2123 2130 6.139679 TCTTAGGGTGATCCTTTTGTCAAT 57.860 37.500 0.0 0.0 45.47 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.