Multiple sequence alignment - TraesCS2B01G331400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G331400 chr2B 100.000 2211 0 0 1 2211 474913327 474911117 0.000000e+00 4084
1 TraesCS2B01G331400 chr3B 98.606 2224 16 4 1 2211 101916063 101913842 0.000000e+00 3921
2 TraesCS2B01G331400 chr3B 97.976 2223 31 3 1 2211 201531911 201529691 0.000000e+00 3843
3 TraesCS2B01G331400 chr5D 97.932 2224 28 4 1 2211 503223103 503220885 0.000000e+00 3836
4 TraesCS2B01G331400 chr5D 97.258 2225 39 7 1 2211 6193823 6191607 0.000000e+00 3751
5 TraesCS2B01G331400 chr5D 97.483 1907 28 11 318 2211 446178864 446176965 0.000000e+00 3238
6 TraesCS2B01G331400 chrUn 97.842 2224 26 6 1 2211 216513722 216515936 0.000000e+00 3821
7 TraesCS2B01G331400 chrUn 97.842 2224 26 6 1 2211 286269661 286267447 0.000000e+00 3821
8 TraesCS2B01G331400 chrUn 97.822 1010 9 5 1213 2211 421835931 421834924 0.000000e+00 1731
9 TraesCS2B01G331400 chr3D 97.797 2224 28 6 1 2211 589272073 589274288 0.000000e+00 3816
10 TraesCS2B01G331400 chr1D 97.527 2224 35 5 1 2211 254393229 254395445 0.000000e+00 3784
11 TraesCS2B01G331400 chr1D 96.619 1804 42 4 420 2211 51922207 51924003 0.000000e+00 2976
12 TraesCS2B01G331400 chr3A 97.437 2224 35 9 1 2211 672905129 672907343 0.000000e+00 3771
13 TraesCS2B01G331400 chr3A 97.302 2224 38 10 1 2211 594894744 594896958 0.000000e+00 3755
14 TraesCS2B01G331400 chr4D 96.358 2224 57 7 1 2211 19933452 19931240 0.000000e+00 3637
15 TraesCS2B01G331400 chr6D 92.357 157 1 1 2066 2211 168257749 168257593 1.720000e-51 213


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G331400 chr2B 474911117 474913327 2210 True 4084 4084 100.000 1 2211 1 chr2B.!!$R1 2210
1 TraesCS2B01G331400 chr3B 101913842 101916063 2221 True 3921 3921 98.606 1 2211 1 chr3B.!!$R1 2210
2 TraesCS2B01G331400 chr3B 201529691 201531911 2220 True 3843 3843 97.976 1 2211 1 chr3B.!!$R2 2210
3 TraesCS2B01G331400 chr5D 503220885 503223103 2218 True 3836 3836 97.932 1 2211 1 chr5D.!!$R3 2210
4 TraesCS2B01G331400 chr5D 6191607 6193823 2216 True 3751 3751 97.258 1 2211 1 chr5D.!!$R1 2210
5 TraesCS2B01G331400 chr5D 446176965 446178864 1899 True 3238 3238 97.483 318 2211 1 chr5D.!!$R2 1893
6 TraesCS2B01G331400 chrUn 216513722 216515936 2214 False 3821 3821 97.842 1 2211 1 chrUn.!!$F1 2210
7 TraesCS2B01G331400 chrUn 286267447 286269661 2214 True 3821 3821 97.842 1 2211 1 chrUn.!!$R1 2210
8 TraesCS2B01G331400 chrUn 421834924 421835931 1007 True 1731 1731 97.822 1213 2211 1 chrUn.!!$R2 998
9 TraesCS2B01G331400 chr3D 589272073 589274288 2215 False 3816 3816 97.797 1 2211 1 chr3D.!!$F1 2210
10 TraesCS2B01G331400 chr1D 254393229 254395445 2216 False 3784 3784 97.527 1 2211 1 chr1D.!!$F2 2210
11 TraesCS2B01G331400 chr1D 51922207 51924003 1796 False 2976 2976 96.619 420 2211 1 chr1D.!!$F1 1791
12 TraesCS2B01G331400 chr3A 672905129 672907343 2214 False 3771 3771 97.437 1 2211 1 chr3A.!!$F2 2210
13 TraesCS2B01G331400 chr3A 594894744 594896958 2214 False 3755 3755 97.302 1 2211 1 chr3A.!!$F1 2210
14 TraesCS2B01G331400 chr4D 19931240 19933452 2212 True 3637 3637 96.358 1 2211 1 chr4D.!!$R1 2210

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
426 429 2.36212 GTGGATGGCAAGCAGGCT 60.362 61.111 0.0 0.0 44.55 4.58 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2107 2119 1.422781 TCACCCGATCCGATAGTACCT 59.577 52.381 0.0 0.0 0.0 3.08 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
426 429 2.362120 GTGGATGGCAAGCAGGCT 60.362 61.111 0.0 0.0 44.55 4.58
443 446 5.360999 AGCAGGCTTATATTTCTTGGTTTCC 59.639 40.000 0.0 0.0 0.00 3.13
857 860 7.517320 ACCAGACCATGCACATTCTTATTATA 58.483 34.615 0.0 0.0 0.00 0.98
1267 1270 3.979911 TGCCTTGATGGTGAAATGGTAT 58.020 40.909 0.0 0.0 38.35 2.73
1848 1858 4.670765 AGAACCATGAAAAGCAAGATCCT 58.329 39.130 0.0 0.0 0.00 3.24
2135 2158 2.940158 TCGGATCGGGTGAATTAGAGA 58.060 47.619 0.0 0.0 0.00 3.10
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
342 344 2.894765 GCCTCCTAGGGATAAGAGACAC 59.105 54.545 9.46 0.0 35.37 3.67
426 429 9.847224 GAGTCCTATGGAAACCAAGAAATATAA 57.153 33.333 0.00 0.0 36.95 0.98
443 446 4.279671 AGAACGCTCATAAGGAGTCCTATG 59.720 45.833 13.43 15.5 45.88 2.23
794 797 8.850156 TGAACTTATAATCTGATGATCGAGTCA 58.150 33.333 0.00 0.0 42.06 3.41
830 833 2.880443 AGAATGTGCATGGTCTGGTTT 58.120 42.857 0.00 0.0 0.00 3.27
857 860 0.253327 GGCTCGAATGACCCCTTCTT 59.747 55.000 0.00 0.0 0.00 2.52
896 899 7.613551 AGGACGTAGGGATTTCTATGTAAAT 57.386 36.000 0.00 0.0 38.98 1.40
1267 1270 3.499048 GAGATTTTGAGTCTCGCGTGTA 58.501 45.455 5.77 0.0 33.48 2.90
1362 1365 5.163343 CCCAGATTTCCGGAATACTTCTACA 60.163 44.000 19.62 0.0 0.00 2.74
1848 1858 6.292923 TCCTCGGTTTCTGTTTTCTTATTCA 58.707 36.000 0.00 0.0 0.00 2.57
2107 2119 1.422781 TCACCCGATCCGATAGTACCT 59.577 52.381 0.00 0.0 0.00 3.08


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.