Multiple sequence alignment - TraesCS2B01G331200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G331200 chr2B 100.000 2141 0 0 1 2141 474908690 474910830 0.000000e+00 3954
1 TraesCS2B01G331200 chr2B 95.696 1185 49 2 781 1965 465000208 464999026 0.000000e+00 1905
2 TraesCS2B01G331200 chr2B 97.436 351 5 1 1 347 771170454 771170104 1.410000e-166 595
3 TraesCS2B01G331200 chr2B 95.849 265 11 0 251 515 616580635 616580371 1.520000e-116 429
4 TraesCS2B01G331200 chr2B 98.438 192 3 0 1912 2103 289693011 289692820 2.630000e-89 339
5 TraesCS2B01G331200 chr2B 94.286 105 2 1 177 277 516991810 516991706 7.910000e-35 158
6 TraesCS2B01G331200 chr2B 93.103 87 3 3 54 138 312928578 312928493 8.020000e-25 124
7 TraesCS2B01G331200 chr2B 93.827 81 5 0 1 81 607685766 607685686 2.890000e-24 122
8 TraesCS2B01G331200 chr1A 98.322 2145 31 2 1 2141 554512485 554514628 0.000000e+00 3757
9 TraesCS2B01G331200 chr5D 98.228 2145 33 2 1 2141 503218455 503220598 0.000000e+00 3746
10 TraesCS2B01G331200 chr5D 97.949 2145 39 2 1 2141 503277989 503275846 0.000000e+00 3712
11 TraesCS2B01G331200 chr3B 98.135 2145 35 2 1 2141 201527261 201529404 0.000000e+00 3735
12 TraesCS2B01G331200 chr3B 95.964 2007 73 5 139 2141 700786918 700784916 0.000000e+00 3251
13 TraesCS2B01G331200 chr3B 98.565 1672 23 1 470 2141 101911885 101913555 0.000000e+00 2953
14 TraesCS2B01G331200 chr3B 98.714 311 4 0 474 784 101918198 101918508 8.630000e-154 553
15 TraesCS2B01G331200 chr3B 97.484 159 4 0 1 159 810706446 810706288 2.710000e-69 272
16 TraesCS2B01G331200 chr3B 99.123 114 1 0 299 412 89098781 89098894 2.790000e-49 206
17 TraesCS2B01G331200 chr3B 97.531 81 2 0 405 485 124271747 124271667 2.870000e-29 139
18 TraesCS2B01G331200 chr3D 97.995 2145 35 4 1 2141 589279305 589277165 0.000000e+00 3716
19 TraesCS2B01G331200 chr3A 97.949 2145 37 4 1 2141 672909770 672907629 0.000000e+00 3711


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G331200 chr2B 474908690 474910830 2140 False 3954 3954 100.000 1 2141 1 chr2B.!!$F1 2140
1 TraesCS2B01G331200 chr2B 464999026 465000208 1182 True 1905 1905 95.696 781 1965 1 chr2B.!!$R3 1184
2 TraesCS2B01G331200 chr1A 554512485 554514628 2143 False 3757 3757 98.322 1 2141 1 chr1A.!!$F1 2140
3 TraesCS2B01G331200 chr5D 503218455 503220598 2143 False 3746 3746 98.228 1 2141 1 chr5D.!!$F1 2140
4 TraesCS2B01G331200 chr5D 503275846 503277989 2143 True 3712 3712 97.949 1 2141 1 chr5D.!!$R1 2140
5 TraesCS2B01G331200 chr3B 201527261 201529404 2143 False 3735 3735 98.135 1 2141 1 chr3B.!!$F4 2140
6 TraesCS2B01G331200 chr3B 700784916 700786918 2002 True 3251 3251 95.964 139 2141 1 chr3B.!!$R2 2002
7 TraesCS2B01G331200 chr3B 101911885 101913555 1670 False 2953 2953 98.565 470 2141 1 chr3B.!!$F2 1671
8 TraesCS2B01G331200 chr3D 589277165 589279305 2140 True 3716 3716 97.995 1 2141 1 chr3D.!!$R1 2140
9 TraesCS2B01G331200 chr3A 672907629 672909770 2141 True 3711 3711 97.949 1 2141 1 chr3A.!!$R1 2140

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
111 112 1.573108 TCTCTTCTCACCATCCCCAC 58.427 55.000 0.0 0.0 0.0 4.61 F
1071 1078 1.216678 ACACCTCTCCAGATCCTCGAT 59.783 52.381 0.0 0.0 0.0 3.59 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1077 1084 4.87658 TCTTGATCCCTCTCAATCTCTCA 58.123 43.478 0.0 0.0 34.76 3.27 R
2110 2119 7.04103 TGACTGCAATATTTTTCTGTCGGTAAA 60.041 33.333 0.0 0.0 32.41 2.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
111 112 1.573108 TCTCTTCTCACCATCCCCAC 58.427 55.000 0.00 0.00 0.00 4.61
447 453 5.952347 AGAAGTGGAATAGAATAACCCGT 57.048 39.130 0.00 0.00 0.00 5.28
488 494 4.765273 ACGTCTGTAATGCATTGTATGGA 58.235 39.130 22.27 9.66 34.26 3.41
498 504 5.372343 TGCATTGTATGGACCAGAATAGT 57.628 39.130 0.00 0.00 0.00 2.12
609 615 5.677319 TCTGTCTTAGTGAATCCCGATTT 57.323 39.130 0.00 0.00 0.00 2.17
1036 1043 3.744238 TCCGAGATGGCAAATATTCGA 57.256 42.857 0.00 0.00 37.80 3.71
1060 1067 5.983540 AGATGACTATGAAAACACCTCTCC 58.016 41.667 0.00 0.00 0.00 3.71
1061 1068 5.485353 AGATGACTATGAAAACACCTCTCCA 59.515 40.000 0.00 0.00 0.00 3.86
1071 1078 1.216678 ACACCTCTCCAGATCCTCGAT 59.783 52.381 0.00 0.00 0.00 3.59
1077 1084 4.040217 CCTCTCCAGATCCTCGATTTGAAT 59.960 45.833 0.00 0.00 0.00 2.57
1357 1364 2.233305 ACCTCGTGTGGGACTAATCT 57.767 50.000 0.00 0.00 0.00 2.40
1529 1538 6.349363 GGCTTCTTATTCCACAAGAACGAAAT 60.349 38.462 0.00 0.00 37.15 2.17
1537 1546 5.369833 TCCACAAGAACGAAATCACCTTTA 58.630 37.500 0.00 0.00 0.00 1.85
1937 1946 5.674525 TGGAACGAGCATGAAGAGATTAAT 58.325 37.500 0.00 0.00 0.00 1.40
2110 2119 1.001641 GGTGCTCTGGTGCAATCCT 60.002 57.895 0.00 0.00 45.12 3.24
2126 2135 5.242838 TGCAATCCTTTACCGACAGAAAAAT 59.757 36.000 0.00 0.00 0.00 1.82
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
111 112 6.667007 TGCATACATTTGTCTCATACACTG 57.333 37.500 0.00 0.00 38.00 3.66
447 453 6.761242 CAGACGTATGATCATTACCCTTCAAA 59.239 38.462 14.65 0.00 0.00 2.69
498 504 6.958767 CCTGGAAAAGGTAGAAGAATAGGAA 58.041 40.000 0.00 0.00 41.74 3.36
1036 1043 6.013379 TGGAGAGGTGTTTTCATAGTCATCTT 60.013 38.462 0.00 0.00 0.00 2.40
1060 1067 5.840715 TCTCTCATTCAAATCGAGGATCTG 58.159 41.667 0.00 0.00 0.00 2.90
1061 1068 6.669125 ATCTCTCATTCAAATCGAGGATCT 57.331 37.500 0.00 0.00 0.00 2.75
1071 1078 6.157471 TGATCCCTCTCAATCTCTCATTCAAA 59.843 38.462 0.00 0.00 0.00 2.69
1077 1084 4.876580 TCTTGATCCCTCTCAATCTCTCA 58.123 43.478 0.00 0.00 34.76 3.27
1296 1303 8.650490 TGTCTGATAATGAGCAAGGAATATACA 58.350 33.333 0.00 0.00 0.00 2.29
1357 1364 9.487790 GTTTTCCATGAGATGGTAAATGAAAAA 57.512 29.630 9.71 2.71 46.61 1.94
1537 1546 9.990868 AAAAACCCCTAGTATATGAAAGAATGT 57.009 29.630 0.00 0.00 0.00 2.71
1708 1717 7.987458 CCCAAGTTTGTCTATGAAGAGCTAATA 59.013 37.037 0.00 0.00 30.45 0.98
1937 1946 8.567285 AAAACTCAAAAGAGAAAGAAGTCTCA 57.433 30.769 5.10 0.00 45.55 3.27
2060 2069 9.814899 CTTCTAATAGGCCATGAACTATAGATG 57.185 37.037 5.01 0.00 30.13 2.90
2110 2119 7.041030 TGACTGCAATATTTTTCTGTCGGTAAA 60.041 33.333 0.00 0.00 32.41 2.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.