Multiple sequence alignment - TraesCS2B01G331100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G331100 chr2B 100.000 2282 0 0 1 2282 474910377 474908096 0.000000e+00 4215.0
1 TraesCS2B01G331100 chr1A 98.338 2286 34 1 1 2282 554514176 554511891 0.000000e+00 4008.0
2 TraesCS2B01G331100 chr5D 98.206 2286 37 1 1 2282 503220146 503217861 0.000000e+00 3991.0
3 TraesCS2B01G331100 chr5D 98.160 2283 38 1 1 2279 503276298 503278580 0.000000e+00 3980.0
4 TraesCS2B01G331100 chr3B 98.163 2286 38 1 1 2282 201528952 201526667 0.000000e+00 3986.0
5 TraesCS2B01G331100 chr3B 95.689 1554 60 4 1 1550 700785368 700786918 0.000000e+00 2492.0
6 TraesCS2B01G331100 chr3B 98.441 1219 19 0 1 1219 101913103 101911885 0.000000e+00 2146.0
7 TraesCS2B01G331100 chr3B 97.043 575 17 0 1530 2104 810706288 810706862 0.000000e+00 968.0
8 TraesCS2B01G331100 chr3B 97.859 327 7 0 1956 2282 717181436 717181110 1.180000e-157 566.0
9 TraesCS2B01G331100 chr3B 98.714 311 4 0 905 1215 101918508 101918198 9.210000e-154 553.0
10 TraesCS2B01G331100 chr3B 97.902 286 6 0 1005 1290 201500335 201500620 1.570000e-136 496.0
11 TraesCS2B01G331100 chr3B 97.880 283 5 1 751 1033 661927686 661927967 2.630000e-134 488.0
12 TraesCS2B01G331100 chr3B 90.878 296 25 2 437 730 754852383 754852088 1.640000e-106 396.0
13 TraesCS2B01G331100 chr3B 98.870 177 2 0 668 844 263226005 263226181 1.320000e-82 316.0
14 TraesCS2B01G331100 chr3B 99.123 114 1 0 1277 1390 89098894 89098781 2.970000e-49 206.0
15 TraesCS2B01G331100 chr3B 92.373 118 2 2 382 499 8020985 8020875 6.520000e-36 161.0
16 TraesCS2B01G331100 chr3B 96.471 85 3 0 2008 2092 122824029 122824113 8.500000e-30 141.0
17 TraesCS2B01G331100 chr3B 96.386 83 3 0 171 253 416933225 416933143 1.100000e-28 137.0
18 TraesCS2B01G331100 chr3B 98.592 71 1 0 1348 1418 349176203 349176273 2.380000e-25 126.0
19 TraesCS2B01G331100 chr3B 98.276 58 1 0 1362 1419 618165414 618165357 4.010000e-18 102.0
20 TraesCS2B01G331100 chr3B 100.000 41 0 0 2239 2279 260631389 260631429 2.430000e-10 76.8
21 TraesCS2B01G331100 chr3B 95.349 43 2 0 1 43 460131663 460131705 4.070000e-08 69.4
22 TraesCS2B01G331100 chr3D 98.029 2283 38 3 1 2279 589277617 589279896 0.000000e+00 3960.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G331100 chr2B 474908096 474910377 2281 True 4215 4215 100.000 1 2282 1 chr2B.!!$R1 2281
1 TraesCS2B01G331100 chr1A 554511891 554514176 2285 True 4008 4008 98.338 1 2282 1 chr1A.!!$R1 2281
2 TraesCS2B01G331100 chr5D 503217861 503220146 2285 True 3991 3991 98.206 1 2282 1 chr5D.!!$R1 2281
3 TraesCS2B01G331100 chr5D 503276298 503278580 2282 False 3980 3980 98.160 1 2279 1 chr5D.!!$F1 2278
4 TraesCS2B01G331100 chr3B 201526667 201528952 2285 True 3986 3986 98.163 1 2282 1 chr3B.!!$R5 2281
5 TraesCS2B01G331100 chr3B 700785368 700786918 1550 False 2492 2492 95.689 1 1550 1 chr3B.!!$F8 1549
6 TraesCS2B01G331100 chr3B 101911885 101913103 1218 True 2146 2146 98.441 1 1219 1 chr3B.!!$R3 1218
7 TraesCS2B01G331100 chr3B 810706288 810706862 574 False 968 968 97.043 1530 2104 1 chr3B.!!$F9 574
8 TraesCS2B01G331100 chr3D 589277617 589279896 2279 False 3960 3960 98.029 1 2279 1 chr3D.!!$F1 2278

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
610 611 4.87658 TCTTGATCCCTCTCAATCTCTCA 58.123 43.478 0.0 0.0 34.76 3.27 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1576 1581 1.573108 TCTCTTCTCACCATCCCCAC 58.427 55.0 0.0 0.0 0.0 4.61 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
150 151 9.990868 AAAAACCCCTAGTATATGAAAGAATGT 57.009 29.630 0.00 0.00 0.00 2.71
330 331 9.487790 GTTTTCCATGAGATGGTAAATGAAAAA 57.512 29.630 9.71 2.71 46.61 1.94
391 392 8.650490 TGTCTGATAATGAGCAAGGAATATACA 58.350 33.333 0.00 0.00 0.00 2.29
610 611 4.876580 TCTTGATCCCTCTCAATCTCTCA 58.123 43.478 0.00 0.00 34.76 3.27
616 617 6.157471 TGATCCCTCTCAATCTCTCATTCAAA 59.843 38.462 0.00 0.00 0.00 2.69
626 627 6.669125 ATCTCTCATTCAAATCGAGGATCT 57.331 37.500 0.00 0.00 0.00 2.75
627 628 5.840715 TCTCTCATTCAAATCGAGGATCTG 58.159 41.667 0.00 0.00 0.00 2.90
651 652 6.013379 TGGAGAGGTGTTTTCATAGTCATCTT 60.013 38.462 0.00 0.00 0.00 2.40
1189 1190 6.958767 CCTGGAAAAGGTAGAAGAATAGGAA 58.041 40.000 0.00 0.00 41.74 3.36
1240 1241 6.761242 CAGACGTATGATCATTACCCTTCAAA 59.239 38.462 14.65 0.00 0.00 2.69
1576 1581 6.667007 TGCATACATTTGTCTCATACACTG 57.333 37.500 0.00 0.00 38.00 3.66
1756 1761 6.695292 GTTTACGACGAAACCTAGAAATCA 57.305 37.500 0.00 0.00 33.93 2.57
2000 2005 4.460382 TCAGAGGCAAATTGAAAGCTAAGG 59.540 41.667 0.00 0.00 0.00 2.69
2040 2045 2.976882 CGGGGGAAAATAGGGATGTCTA 59.023 50.000 0.00 0.00 0.00 2.59
2279 2284 9.733556 AGAGATCGTCATATACATCTAGAAAGT 57.266 33.333 0.00 1.14 30.75 2.66
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
150 151 5.369833 TCCACAAGAACGAAATCACCTTTA 58.630 37.500 0.00 0.00 0.00 1.85
158 159 6.349363 GGCTTCTTATTCCACAAGAACGAAAT 60.349 38.462 0.00 0.00 37.15 2.17
330 331 2.233305 ACCTCGTGTGGGACTAATCT 57.767 50.000 0.00 0.00 0.00 2.40
610 611 4.040217 CCTCTCCAGATCCTCGATTTGAAT 59.960 45.833 0.00 0.00 0.00 2.57
616 617 1.216678 ACACCTCTCCAGATCCTCGAT 59.783 52.381 0.00 0.00 0.00 3.59
626 627 5.485353 AGATGACTATGAAAACACCTCTCCA 59.515 40.000 0.00 0.00 0.00 3.86
627 628 5.983540 AGATGACTATGAAAACACCTCTCC 58.016 41.667 0.00 0.00 0.00 3.71
651 652 3.744238 TCCGAGATGGCAAATATTCGA 57.256 42.857 0.00 0.00 37.80 3.71
1078 1079 5.677319 TCTGTCTTAGTGAATCCCGATTT 57.323 39.130 0.00 0.00 0.00 2.17
1189 1190 5.372343 TGCATTGTATGGACCAGAATAGT 57.628 39.130 0.00 0.00 0.00 2.12
1199 1200 4.765273 ACGTCTGTAATGCATTGTATGGA 58.235 39.130 22.27 9.66 34.26 3.41
1240 1241 5.952347 AGAAGTGGAATAGAATAACCCGT 57.048 39.130 0.00 0.00 0.00 5.28
1576 1581 1.573108 TCTCTTCTCACCATCCCCAC 58.427 55.000 0.00 0.00 0.00 4.61
1756 1761 6.725364 AGGTAGTCAAATTGGATCAGTGATT 58.275 36.000 7.16 0.00 0.00 2.57
1819 1824 3.813443 ACTGAACTCAATCACTTGCTGT 58.187 40.909 0.00 0.00 32.11 4.40
2000 2005 2.158856 CCGGGGGTCTTAATTACCACTC 60.159 54.545 8.78 0.00 40.51 3.51
2040 2045 6.982160 TCCACATATTATGGGTAACGTAGT 57.018 37.500 8.48 0.00 39.60 2.73
2171 2176 3.635591 AGGAATCCAAATCTGCCGAATT 58.364 40.909 0.61 0.00 0.00 2.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.