Multiple sequence alignment - TraesCS2B01G330900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G330900 chr2B 100.000 3385 0 0 1 3385 474909712 474906328 0.000000e+00 6252.0
1 TraesCS2B01G330900 chr2B 97.917 48 1 0 2691 2738 755374055 755374102 2.160000e-12 84.2
2 TraesCS2B01G330900 chr3D 98.252 2746 36 7 1 2738 589278282 589281023 0.000000e+00 4795.0
3 TraesCS2B01G330900 chrUn 98.489 2713 30 7 1 2704 93408369 93411079 0.000000e+00 4772.0
4 TraesCS2B01G330900 chrUn 98.120 2713 41 6 1 2704 216517340 216520051 0.000000e+00 4719.0
5 TraesCS2B01G330900 chr5D 98.451 2712 34 4 1 2704 503219481 503216770 0.000000e+00 4769.0
6 TraesCS2B01G330900 chr5D 98.133 2732 44 3 1 2725 503276963 503279694 0.000000e+00 4756.0
7 TraesCS2B01G330900 chr5D 98.061 2733 45 4 1 2725 6190203 6187471 0.000000e+00 4747.0
8 TraesCS2B01G330900 chr5D 98.162 653 11 1 2733 3385 6236777 6237428 0.000000e+00 1138.0
9 TraesCS2B01G330900 chr5D 97.703 653 14 1 2733 3385 503330033 503329382 0.000000e+00 1122.0
10 TraesCS2B01G330900 chr3B 98.415 2713 33 6 1 2704 201528287 201525576 0.000000e+00 4763.0
11 TraesCS2B01G330900 chr3B 98.315 653 10 1 2733 3385 201492125 201491474 0.000000e+00 1144.0
12 TraesCS2B01G330900 chr6D 98.378 2713 35 5 1 2704 168256189 168253477 0.000000e+00 4758.0
13 TraesCS2B01G330900 chr1D 97.769 2734 51 6 1 2725 254396847 254399579 0.000000e+00 4702.0
14 TraesCS2B01G330900 chr1D 97.856 653 13 1 2733 3385 290506290 290505639 0.000000e+00 1127.0
15 TraesCS2B01G330900 chr1D 97.243 653 16 2 2733 3385 254476120 254475470 0.000000e+00 1105.0
16 TraesCS2B01G330900 chr1D 97.368 38 1 0 2701 2738 254399610 254399573 7.840000e-07 65.8
17 TraesCS2B01G330900 chr2D 98.469 653 9 1 2733 3385 33930585 33931236 0.000000e+00 1149.0
18 TraesCS2B01G330900 chr1A 98.315 653 10 1 2733 3385 554448823 554449474 0.000000e+00 1144.0
19 TraesCS2B01G330900 chr4A 97.856 653 13 1 2733 3385 141129363 141128712 0.000000e+00 1127.0
20 TraesCS2B01G330900 chr4A 97.243 653 15 2 2733 3385 309375269 309375918 0.000000e+00 1103.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G330900 chr2B 474906328 474909712 3384 True 6252 6252 100.000 1 3385 1 chr2B.!!$R1 3384
1 TraesCS2B01G330900 chr3D 589278282 589281023 2741 False 4795 4795 98.252 1 2738 1 chr3D.!!$F1 2737
2 TraesCS2B01G330900 chrUn 93408369 93411079 2710 False 4772 4772 98.489 1 2704 1 chrUn.!!$F1 2703
3 TraesCS2B01G330900 chrUn 216517340 216520051 2711 False 4719 4719 98.120 1 2704 1 chrUn.!!$F2 2703
4 TraesCS2B01G330900 chr5D 503216770 503219481 2711 True 4769 4769 98.451 1 2704 1 chr5D.!!$R2 2703
5 TraesCS2B01G330900 chr5D 503276963 503279694 2731 False 4756 4756 98.133 1 2725 1 chr5D.!!$F2 2724
6 TraesCS2B01G330900 chr5D 6187471 6190203 2732 True 4747 4747 98.061 1 2725 1 chr5D.!!$R1 2724
7 TraesCS2B01G330900 chr5D 6236777 6237428 651 False 1138 1138 98.162 2733 3385 1 chr5D.!!$F1 652
8 TraesCS2B01G330900 chr5D 503329382 503330033 651 True 1122 1122 97.703 2733 3385 1 chr5D.!!$R3 652
9 TraesCS2B01G330900 chr3B 201525576 201528287 2711 True 4763 4763 98.415 1 2704 1 chr3B.!!$R2 2703
10 TraesCS2B01G330900 chr3B 201491474 201492125 651 True 1144 1144 98.315 2733 3385 1 chr3B.!!$R1 652
11 TraesCS2B01G330900 chr6D 168253477 168256189 2712 True 4758 4758 98.378 1 2704 1 chr6D.!!$R1 2703
12 TraesCS2B01G330900 chr1D 254396847 254399579 2732 False 4702 4702 97.769 1 2725 1 chr1D.!!$F1 2724
13 TraesCS2B01G330900 chr1D 290505639 290506290 651 True 1127 1127 97.856 2733 3385 1 chr1D.!!$R3 652
14 TraesCS2B01G330900 chr1D 254475470 254476120 650 True 1105 1105 97.243 2733 3385 1 chr1D.!!$R2 652
15 TraesCS2B01G330900 chr2D 33930585 33931236 651 False 1149 1149 98.469 2733 3385 1 chr2D.!!$F1 652
16 TraesCS2B01G330900 chr1A 554448823 554449474 651 False 1144 1144 98.315 2733 3385 1 chr1A.!!$F1 652
17 TraesCS2B01G330900 chr4A 141128712 141129363 651 True 1127 1127 97.856 2733 3385 1 chr4A.!!$R1 652
18 TraesCS2B01G330900 chr4A 309375269 309375918 649 False 1103 1103 97.243 2733 3385 1 chr4A.!!$F1 652

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
714 715 2.562298 GGCAAGTGAAATCCAATCCACA 59.438 45.455 0.0 0.0 32.35 4.17 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2503 2514 0.391793 TCGCGATTGTATGGCCAACA 60.392 50.0 10.96 13.21 0.0 3.33 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
524 525 6.958767 CCTGGAAAAGGTAGAAGAATAGGAA 58.041 40.000 0.00 0.0 41.74 3.36
575 576 6.761242 CAGACGTATGATCATTACCCTTCAAA 59.239 38.462 14.65 0.0 0.00 2.69
714 715 2.562298 GGCAAGTGAAATCCAATCCACA 59.438 45.455 0.00 0.0 32.35 4.17
911 916 6.667007 TGCATACATTTGTCTCATACACTG 57.333 37.500 0.00 0.0 38.00 3.66
1091 1096 6.695292 GTTTACGACGAAACCTAGAAATCA 57.305 37.500 0.00 0.0 33.93 2.57
1335 1340 4.460382 TCAGAGGCAAATTGAAAGCTAAGG 59.540 41.667 0.00 0.0 0.00 2.69
1375 1380 2.976882 CGGGGGAAAATAGGGATGTCTA 59.023 50.000 0.00 0.0 0.00 2.59
1700 1707 2.404559 TCAACCGATATGCCCTTAGGT 58.595 47.619 0.00 0.0 34.57 3.08
2001 2008 2.359011 GGGGCGGTGAAGGGAAAT 59.641 61.111 0.00 0.0 0.00 2.17
2232 2241 1.171308 CCACTGCCTTGATCCACTTG 58.829 55.000 0.00 0.0 0.00 3.16
2382 2392 4.833478 AAGGAGTAATCAGCTGTGACAT 57.167 40.909 14.67 0.0 34.75 3.06
2409 2420 5.372547 AAAACGAATCCTTTTGTAGCTCC 57.627 39.130 0.00 0.0 0.00 4.70
2477 2488 5.479124 AGAAACAATAGTAACGTGGTCCT 57.521 39.130 0.00 0.0 0.00 3.85
2503 2514 4.823989 GCATCTAGCATTCTACCCACAATT 59.176 41.667 0.00 0.0 44.79 2.32
2775 2789 3.435671 GTCACAAGCTTTATGTTAGGCGT 59.564 43.478 0.00 0.0 0.00 5.68
2903 2917 7.802117 TCCTACAAATTAGTGAATTAGGAGGG 58.198 38.462 0.00 0.0 34.48 4.30
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
413 414 5.677319 TCTGTCTTAGTGAATCCCGATTT 57.323 39.130 0.00 0.00 0.00 2.17
524 525 5.372343 TGCATTGTATGGACCAGAATAGT 57.628 39.130 0.00 0.00 0.00 2.12
534 535 4.765273 ACGTCTGTAATGCATTGTATGGA 58.235 39.130 22.27 9.66 34.26 3.41
575 576 5.952347 AGAAGTGGAATAGAATAACCCGT 57.048 39.130 0.00 0.00 0.00 5.28
714 715 5.128499 TGCCGTCCATGGATCAAATTATTTT 59.872 36.000 19.62 0.00 0.00 1.82
911 916 1.573108 TCTCTTCTCACCATCCCCAC 58.427 55.000 0.00 0.00 0.00 4.61
1091 1096 6.725364 AGGTAGTCAAATTGGATCAGTGATT 58.275 36.000 7.16 0.00 0.00 2.57
1154 1159 3.813443 ACTGAACTCAATCACTTGCTGT 58.187 40.909 0.00 0.00 32.11 4.40
1335 1340 2.158856 CCGGGGGTCTTAATTACCACTC 60.159 54.545 8.78 0.00 40.51 3.51
1375 1380 6.982160 TCCACATATTATGGGTAACGTAGT 57.018 37.500 8.48 0.00 39.60 2.73
1506 1511 3.635591 AGGAATCCAAATCTGCCGAATT 58.364 40.909 0.61 0.00 0.00 2.17
1700 1707 4.344359 TTCTATGTTATGCATGGCCGTA 57.656 40.909 10.16 2.00 38.47 4.02
1767 1774 6.071728 CCCTCTTTTGCAATGAGTTTCACTAT 60.072 38.462 21.02 0.00 32.43 2.12
1771 1778 3.960102 ACCCTCTTTTGCAATGAGTTTCA 59.040 39.130 21.02 0.00 32.43 2.69
2409 2420 9.525409 CCTTTTCTATCTTTGCCAATAAATGAG 57.475 33.333 0.00 0.00 0.00 2.90
2477 2488 1.699634 GGGTAGAATGCTAGATGCCCA 59.300 52.381 0.00 0.00 42.00 5.36
2503 2514 0.391793 TCGCGATTGTATGGCCAACA 60.392 50.000 10.96 13.21 0.00 3.33
2613 2624 7.523293 TCCTTTCTTGCATTTTCATAACTCA 57.477 32.000 0.00 0.00 0.00 3.41
2850 2864 9.325198 GGTACTGAACTTTTGGATTTGAATTTT 57.675 29.630 0.00 0.00 0.00 1.82
2851 2865 8.704668 AGGTACTGAACTTTTGGATTTGAATTT 58.295 29.630 0.00 0.00 37.18 1.82
2852 2866 8.250143 AGGTACTGAACTTTTGGATTTGAATT 57.750 30.769 0.00 0.00 37.18 2.17
2853 2867 7.839680 AGGTACTGAACTTTTGGATTTGAAT 57.160 32.000 0.00 0.00 37.18 2.57
2903 2917 2.579410 TTCTACACAAAAGAGCCCCC 57.421 50.000 0.00 0.00 0.00 5.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.