Multiple sequence alignment - TraesCS2B01G330400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G330400 chr2B 100.000 2255 0 0 1 2255 474895938 474898192 0.000000e+00 4165
1 TraesCS2B01G330400 chr6D 98.451 1291 20 0 1 1291 389255237 389253947 0.000000e+00 2274
2 TraesCS2B01G330400 chr6D 98.296 1291 22 0 1 1291 389250442 389249152 0.000000e+00 2263
3 TraesCS2B01G330400 chr3D 98.451 1291 20 0 1 1291 589265455 589266745 0.000000e+00 2274
4 TraesCS2B01G330400 chr3D 98.457 972 12 3 1286 2255 21903002 21902032 0.000000e+00 1709
5 TraesCS2B01G330400 chr5D 98.373 1291 21 0 1 1291 503267234 503268524 0.000000e+00 2268
6 TraesCS2B01G330400 chr5D 98.218 1291 22 1 1 1291 503239094 503237805 0.000000e+00 2255
7 TraesCS2B01G330400 chr5D 98.765 972 10 2 1286 2255 240136082 240135111 0.000000e+00 1727
8 TraesCS2B01G330400 chr5D 98.045 972 17 2 1286 2255 6202900 6203871 0.000000e+00 1688
9 TraesCS2B01G330400 chr3A 98.373 1291 21 0 1 1291 593312756 593311466 0.000000e+00 2268
10 TraesCS2B01G330400 chr3A 98.218 1291 23 0 1 1291 66007064 66008354 0.000000e+00 2257
11 TraesCS2B01G330400 chr7B 98.373 1291 20 1 1 1291 663101357 663102646 0.000000e+00 2266
12 TraesCS2B01G330400 chr7B 98.218 1291 23 0 1 1291 662724472 662723182 0.000000e+00 2257
13 TraesCS2B01G330400 chr1D 98.457 972 13 2 1286 2255 483916226 483917197 0.000000e+00 1711
14 TraesCS2B01G330400 chr1D 98.249 971 14 2 1286 2255 254496384 254495416 0.000000e+00 1696
15 TraesCS2B01G330400 chr3B 98.457 972 12 3 1286 2255 201511504 201510534 0.000000e+00 1709
16 TraesCS2B01G330400 chr3B 94.787 211 11 0 2045 2255 502647539 502647749 1.670000e-86 329
17 TraesCS2B01G330400 chr2D 97.739 973 19 2 1286 2255 334230870 334229898 0.000000e+00 1672
18 TraesCS2B01G330400 chr4D 96.091 972 34 4 1286 2255 19914874 19913905 0.000000e+00 1581
19 TraesCS2B01G330400 chr7D 98.479 789 10 2 1286 2072 231553132 231552344 0.000000e+00 1389


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G330400 chr2B 474895938 474898192 2254 False 4165.0 4165 100.0000 1 2255 1 chr2B.!!$F1 2254
1 TraesCS2B01G330400 chr6D 389249152 389255237 6085 True 2268.5 2274 98.3735 1 1291 2 chr6D.!!$R1 1290
2 TraesCS2B01G330400 chr3D 589265455 589266745 1290 False 2274.0 2274 98.4510 1 1291 1 chr3D.!!$F1 1290
3 TraesCS2B01G330400 chr3D 21902032 21903002 970 True 1709.0 1709 98.4570 1286 2255 1 chr3D.!!$R1 969
4 TraesCS2B01G330400 chr5D 503267234 503268524 1290 False 2268.0 2268 98.3730 1 1291 1 chr5D.!!$F2 1290
5 TraesCS2B01G330400 chr5D 503237805 503239094 1289 True 2255.0 2255 98.2180 1 1291 1 chr5D.!!$R2 1290
6 TraesCS2B01G330400 chr5D 240135111 240136082 971 True 1727.0 1727 98.7650 1286 2255 1 chr5D.!!$R1 969
7 TraesCS2B01G330400 chr5D 6202900 6203871 971 False 1688.0 1688 98.0450 1286 2255 1 chr5D.!!$F1 969
8 TraesCS2B01G330400 chr3A 593311466 593312756 1290 True 2268.0 2268 98.3730 1 1291 1 chr3A.!!$R1 1290
9 TraesCS2B01G330400 chr3A 66007064 66008354 1290 False 2257.0 2257 98.2180 1 1291 1 chr3A.!!$F1 1290
10 TraesCS2B01G330400 chr7B 663101357 663102646 1289 False 2266.0 2266 98.3730 1 1291 1 chr7B.!!$F1 1290
11 TraesCS2B01G330400 chr7B 662723182 662724472 1290 True 2257.0 2257 98.2180 1 1291 1 chr7B.!!$R1 1290
12 TraesCS2B01G330400 chr1D 483916226 483917197 971 False 1711.0 1711 98.4570 1286 2255 1 chr1D.!!$F1 969
13 TraesCS2B01G330400 chr1D 254495416 254496384 968 True 1696.0 1696 98.2490 1286 2255 1 chr1D.!!$R1 969
14 TraesCS2B01G330400 chr3B 201510534 201511504 970 True 1709.0 1709 98.4570 1286 2255 1 chr3B.!!$R1 969
15 TraesCS2B01G330400 chr2D 334229898 334230870 972 True 1672.0 1672 97.7390 1286 2255 1 chr2D.!!$R1 969
16 TraesCS2B01G330400 chr4D 19913905 19914874 969 True 1581.0 1581 96.0910 1286 2255 1 chr4D.!!$R1 969
17 TraesCS2B01G330400 chr7D 231552344 231553132 788 True 1389.0 1389 98.4790 1286 2072 1 chr7D.!!$R1 786

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
377 378 0.608856 TACTCACCCGTTCGCCACTA 60.609 55.0 0.0 0.0 0.0 2.74 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1848 6648 0.315886 AACGAGTCGCACATACACCA 59.684 50.0 13.59 0.0 0.0 4.17 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
213 214 1.683385 CGGACCAGCTACTGATCATCA 59.317 52.381 0.00 0.00 32.44 3.07
248 249 7.728981 AGCTATTACCTCACCAACTAGCTAATA 59.271 37.037 0.00 0.00 38.82 0.98
319 320 2.678769 CGGGGTATTAGCAACCGTTTCT 60.679 50.000 0.00 0.00 39.70 2.52
377 378 0.608856 TACTCACCCGTTCGCCACTA 60.609 55.000 0.00 0.00 0.00 2.74
560 561 3.133691 TGTATCCATGCGCTTCAGATTC 58.866 45.455 9.73 5.82 0.00 2.52
697 698 3.434940 ACTCACATTGGGTTTAGGGAC 57.565 47.619 0.00 0.00 0.00 4.46
728 729 2.547855 CGAACTGATGACTTCCACCACA 60.548 50.000 0.00 0.00 0.00 4.17
735 736 1.168714 GACTTCCACCACATCAAGGC 58.831 55.000 0.00 0.00 0.00 4.35
1008 5804 3.012518 CGAGCAGGTTTCCATGAAGAAT 58.987 45.455 0.00 0.00 0.00 2.40
1206 6002 8.954350 CATTCAAGAGTTTCTATCTGTTTCCAT 58.046 33.333 0.00 0.00 0.00 3.41
1265 6061 8.928270 AATTACTTCTCTTAGGAACACATACG 57.072 34.615 0.00 0.00 0.00 3.06
1314 6110 1.269569 CGTATAGCATTCCCTCACGCA 60.270 52.381 0.00 0.00 0.00 5.24
1316 6112 2.645838 ATAGCATTCCCTCACGCAAT 57.354 45.000 0.00 0.00 0.00 3.56
1766 6565 3.432933 TGCCGACGGTTAAACAACTTATC 59.567 43.478 16.73 0.00 0.00 1.75
1781 6580 5.295787 ACAACTTATCAGAAACGCAAGACAA 59.704 36.000 0.00 0.00 43.62 3.18
1848 6648 2.025155 AGCGTCGAGGAACATGTCTAT 58.975 47.619 9.75 0.00 0.00 1.98
1868 6668 1.540707 TGGTGTATGTGCGACTCGTTA 59.459 47.619 0.00 0.00 0.00 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
248 249 1.536662 AAGGAGGGGCTCGTGTCTT 60.537 57.895 0.00 0.00 0.00 3.01
319 320 1.822425 TGGGAGGGGAACAACAACTA 58.178 50.000 0.00 0.00 0.00 2.24
377 378 1.808891 CGAACGGGAAGTGGTGTTTCT 60.809 52.381 0.00 0.00 0.00 2.52
560 561 0.741221 GTGGCGAACTCCAGGCTAAG 60.741 60.000 0.00 0.00 36.67 2.18
697 698 1.019673 CATCAGTTCGGGCCTGATTG 58.980 55.000 16.96 16.84 45.12 2.67
706 707 1.001974 TGGTGGAAGTCATCAGTTCGG 59.998 52.381 0.00 0.00 33.22 4.30
728 729 0.456221 CGGTAGAGTGTCGCCTTGAT 59.544 55.000 0.00 0.00 0.00 2.57
735 736 0.522180 AACTCAGCGGTAGAGTGTCG 59.478 55.000 16.61 0.00 45.11 4.35
1008 5804 7.264947 TCGAATAGAACATGCTGAACAAGATA 58.735 34.615 0.00 0.00 0.00 1.98
1206 6002 1.270839 CGAGGTCTCAAGAAAAGGGCA 60.271 52.381 0.00 0.00 0.00 5.36
1265 6061 3.875727 GGGCTACCGTTATCCTTTTTCTC 59.124 47.826 0.00 0.00 0.00 2.87
1314 6110 4.142093 GCAGGTTGGTGAAGCATAATCATT 60.142 41.667 0.00 0.00 31.56 2.57
1316 6112 2.754552 GCAGGTTGGTGAAGCATAATCA 59.245 45.455 0.00 0.00 31.56 2.57
1766 6565 2.842208 TTGGTTGTCTTGCGTTTCTG 57.158 45.000 0.00 0.00 0.00 3.02
1848 6648 0.315886 AACGAGTCGCACATACACCA 59.684 50.000 13.59 0.00 0.00 4.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.