Multiple sequence alignment - TraesCS2B01G319000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G319000 chr2B 100.000 3470 0 0 1 3470 454769164 454765695 0.000000e+00 6408.0
1 TraesCS2B01G319000 chr2B 98.530 3470 46 3 1 3470 7065730 7069194 0.000000e+00 6120.0
2 TraesCS2B01G319000 chr2B 98.271 3470 54 4 1 3470 7027040 7030503 0.000000e+00 6071.0
3 TraesCS2B01G319000 chr2B 97.118 3470 50 7 1 3470 7107444 7110863 0.000000e+00 5808.0
4 TraesCS2B01G319000 chr2B 93.147 2962 164 18 520 3469 6987933 6984999 0.000000e+00 4309.0
5 TraesCS2B01G319000 chr2B 99.417 2058 12 0 1 2058 454742683 454740626 0.000000e+00 3735.0
6 TraesCS2B01G319000 chr2B 100.000 850 0 0 2621 3470 454740126 454739277 0.000000e+00 1570.0
7 TraesCS2B01G319000 chr2B 90.265 226 22 0 1321 1546 6988692 6988467 2.620000e-76 296.0
8 TraesCS2B01G319000 chr2B 86.928 153 19 1 251 403 426824568 426824719 1.660000e-38 171.0
9 TraesCS2B01G319000 chr2A 88.148 1274 122 17 1627 2897 6293287 6292040 0.000000e+00 1489.0
10 TraesCS2B01G319000 chr2A 86.431 678 85 5 834 1510 6294006 6293335 0.000000e+00 736.0
11 TraesCS2B01G319000 chr2A 86.810 326 23 11 3164 3470 6291799 6291475 2.560000e-91 346.0
12 TraesCS2B01G319000 chr2A 94.118 51 3 0 1533 1583 6293335 6293285 1.030000e-10 78.7
13 TraesCS2B01G319000 chrUn 86.271 1231 115 26 2273 3470 11587011 11585802 0.000000e+00 1288.0
14 TraesCS2B01G319000 chr1D 78.892 1336 222 35 1152 2450 490431017 490429705 0.000000e+00 850.0
15 TraesCS2B01G319000 chr5B 78.700 277 57 2 249 524 106360919 106360644 2.130000e-42 183.0
16 TraesCS2B01G319000 chr7A 86.842 152 19 1 249 400 1278670 1278820 5.960000e-38 169.0
17 TraesCS2B01G319000 chr4D 85.526 152 20 2 249 400 106669007 106668858 1.290000e-34 158.0
18 TraesCS2B01G319000 chr3D 84.516 155 24 0 249 403 169725135 169725289 1.670000e-33 154.0
19 TraesCS2B01G319000 chr3D 80.711 197 31 4 581 777 589577921 589577732 2.790000e-31 147.0
20 TraesCS2B01G319000 chr6B 81.667 180 25 5 599 777 481042849 481043021 3.610000e-30 143.0
21 TraesCS2B01G319000 chr5A 81.034 174 25 6 604 776 689612524 689612358 7.810000e-27 132.0
22 TraesCS2B01G319000 chr7D 78.500 200 34 7 582 778 152134103 152133910 4.700000e-24 122.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G319000 chr2B 454765695 454769164 3469 True 6408.000 6408 100.00000 1 3470 1 chr2B.!!$R1 3469
1 TraesCS2B01G319000 chr2B 7065730 7069194 3464 False 6120.000 6120 98.53000 1 3470 1 chr2B.!!$F2 3469
2 TraesCS2B01G319000 chr2B 7027040 7030503 3463 False 6071.000 6071 98.27100 1 3470 1 chr2B.!!$F1 3469
3 TraesCS2B01G319000 chr2B 7107444 7110863 3419 False 5808.000 5808 97.11800 1 3470 1 chr2B.!!$F3 3469
4 TraesCS2B01G319000 chr2B 454739277 454742683 3406 True 2652.500 3735 99.70850 1 3470 2 chr2B.!!$R3 3469
5 TraesCS2B01G319000 chr2B 6984999 6988692 3693 True 2302.500 4309 91.70600 520 3469 2 chr2B.!!$R2 2949
6 TraesCS2B01G319000 chr2A 6291475 6294006 2531 True 662.425 1489 88.87675 834 3470 4 chr2A.!!$R1 2636
7 TraesCS2B01G319000 chrUn 11585802 11587011 1209 True 1288.000 1288 86.27100 2273 3470 1 chrUn.!!$R1 1197
8 TraesCS2B01G319000 chr1D 490429705 490431017 1312 True 850.000 850 78.89200 1152 2450 1 chr1D.!!$R1 1298

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
352 354 6.168389 GCAATCAATCCCACAAATTTCTCTT 58.832 36.000 0.00 0.0 0.0 2.85 F
1521 1775 2.453080 GACATCGACAATAACCGCGTA 58.547 47.619 4.92 0.0 0.0 4.42 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1728 1982 0.966179 TGAGCGTGTCCACATACACT 59.034 50.000 5.68 0.0 46.13 3.55 R
2486 2783 4.957759 ACACAGTACAACCAAGAAACAC 57.042 40.909 0.00 0.0 0.00 3.32 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
27 28 8.031864 CCTAATGCATCAATACGAAGAGAGTAT 58.968 37.037 0.00 0.00 36.45 2.12
352 354 6.168389 GCAATCAATCCCACAAATTTCTCTT 58.832 36.000 0.00 0.00 0.00 2.85
1521 1775 2.453080 GACATCGACAATAACCGCGTA 58.547 47.619 4.92 0.00 0.00 4.42
2300 2595 1.375523 CTGGTAGGGGTGTCGCAAC 60.376 63.158 0.00 0.00 0.00 4.17
2486 2783 4.712476 AGTTAATTAGCTGGGCTGATCAG 58.288 43.478 18.84 18.84 40.10 2.90
2487 2784 4.164988 AGTTAATTAGCTGGGCTGATCAGT 59.835 41.667 23.38 5.58 40.10 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
27 28 7.172532 CCACATTACTTGTCACTGCTTTACTAA 59.827 37.037 0.00 0.0 36.00 2.24
254 255 4.563993 CCTTTGGTGGTGAAAATGCATGAT 60.564 41.667 0.00 0.0 0.00 2.45
352 354 0.248843 TCGCATACACACCTGCATGA 59.751 50.000 0.00 0.0 38.30 3.07
1728 1982 0.966179 TGAGCGTGTCCACATACACT 59.034 50.000 5.68 0.0 46.13 3.55
1931 2202 1.202463 CGACGGCATTGATCTCCTTCT 60.202 52.381 0.00 0.0 0.00 2.85
2300 2595 2.092838 GTGAAGTAGCTTAAGTGCAGCG 59.907 50.000 4.02 0.0 42.55 5.18
2486 2783 4.957759 ACACAGTACAACCAAGAAACAC 57.042 40.909 0.00 0.0 0.00 3.32
2487 2784 5.704888 CAAACACAGTACAACCAAGAAACA 58.295 37.500 0.00 0.0 0.00 2.83


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.