Multiple sequence alignment - TraesCS2B01G314300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G314300 chr2B 100.000 2273 0 0 1 2273 449208697 449210969 0 4198
1 TraesCS2B01G314300 chr2B 99.164 2273 18 1 1 2273 234530529 234532800 0 4091
2 TraesCS2B01G314300 chr3A 99.384 2273 13 1 1 2273 495091909 495094180 0 4119
3 TraesCS2B01G314300 chr3B 99.208 2273 18 0 1 2273 6000135 6002407 0 4098
4 TraesCS2B01G314300 chr7A 99.120 2273 19 1 1 2273 60220134 60222405 0 4085
5 TraesCS2B01G314300 chr4B 98.856 2273 25 1 1 2273 495577616 495579887 0 4052
6 TraesCS2B01G314300 chr1B 98.592 2273 31 1 1 2273 619184700 619186971 0 4019
7 TraesCS2B01G314300 chr6B 97.757 2274 49 2 1 2273 625612108 625614380 0 3916


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G314300 chr2B 449208697 449210969 2272 False 4198 4198 100.000 1 2273 1 chr2B.!!$F2 2272
1 TraesCS2B01G314300 chr2B 234530529 234532800 2271 False 4091 4091 99.164 1 2273 1 chr2B.!!$F1 2272
2 TraesCS2B01G314300 chr3A 495091909 495094180 2271 False 4119 4119 99.384 1 2273 1 chr3A.!!$F1 2272
3 TraesCS2B01G314300 chr3B 6000135 6002407 2272 False 4098 4098 99.208 1 2273 1 chr3B.!!$F1 2272
4 TraesCS2B01G314300 chr7A 60220134 60222405 2271 False 4085 4085 99.120 1 2273 1 chr7A.!!$F1 2272
5 TraesCS2B01G314300 chr4B 495577616 495579887 2271 False 4052 4052 98.856 1 2273 1 chr4B.!!$F1 2272
6 TraesCS2B01G314300 chr1B 619184700 619186971 2271 False 4019 4019 98.592 1 2273 1 chr1B.!!$F1 2272
7 TraesCS2B01G314300 chr6B 625612108 625614380 2272 False 3916 3916 97.757 1 2273 1 chr6B.!!$F1 2272

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
391 392 0.474184 ATCCGAATCCCGCTCCAATT 59.526 50.0 0.0 0.0 36.84 2.32 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1304 1307 5.476091 AGAGAACGAAAGGAGAACAGAAT 57.524 39.13 0.0 0.0 0.0 2.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
391 392 0.474184 ATCCGAATCCCGCTCCAATT 59.526 50.000 0.0 0.0 36.84 2.32
1246 1249 0.824109 CCGAGGGACTATTGCTGTCA 59.176 55.000 0.0 0.0 41.55 3.58
1304 1307 8.434392 ACTACAGGAGAGTTACCAAATACAAAA 58.566 33.333 0.0 0.0 0.00 2.44
1917 1920 7.362920 CGATGGAATTGTTTGATCTTAAAGGGT 60.363 37.037 0.0 0.0 0.00 4.34
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
8 9 3.737266 CGTCTCCGTGTAAAAGCAAACTA 59.263 43.478 0.0 0.0 0.0 2.24
1304 1307 5.476091 AGAGAACGAAAGGAGAACAGAAT 57.524 39.130 0.0 0.0 0.0 2.40
1917 1920 9.653287 CCCTTATGTGCGAAATTATAGAAGATA 57.347 33.333 0.0 0.0 0.0 1.98


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.