Multiple sequence alignment - TraesCS2B01G301700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G301700 chr2B 100.000 2882 0 0 1 2882 424684379 424681498 0.000000e+00 5323
1 TraesCS2B01G301700 chr1B 98.196 2882 50 1 1 2882 95492679 95495558 0.000000e+00 5033
2 TraesCS2B01G301700 chr1B 97.885 2884 54 5 3 2882 530763484 530760604 0.000000e+00 4981
3 TraesCS2B01G301700 chr2A 97.609 2886 61 6 1 2882 374484313 374487194 0.000000e+00 4940
4 TraesCS2B01G301700 chr2A 97.540 2886 64 5 1 2882 628570443 628573325 0.000000e+00 4929
5 TraesCS2B01G301700 chr2A 97.505 2886 66 3 1 2882 628647576 628644693 0.000000e+00 4926
6 TraesCS2B01G301700 chr2A 97.124 2886 71 6 1 2882 161527508 161530385 0.000000e+00 4859
7 TraesCS2B01G301700 chr2A 92.635 353 26 0 1 353 313891389 313891741 2.560000e-140 508
8 TraesCS2B01G301700 chr1A 97.368 2888 68 5 1 2882 409609870 409612755 0.000000e+00 4905
9 TraesCS2B01G301700 chr7D 96.990 2890 75 5 1 2882 474677584 474680469 0.000000e+00 4844
10 TraesCS2B01G301700 chr6A 97.320 2164 52 3 723 2882 610981354 610983515 0.000000e+00 3670


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G301700 chr2B 424681498 424684379 2881 True 5323 5323 100.000 1 2882 1 chr2B.!!$R1 2881
1 TraesCS2B01G301700 chr1B 95492679 95495558 2879 False 5033 5033 98.196 1 2882 1 chr1B.!!$F1 2881
2 TraesCS2B01G301700 chr1B 530760604 530763484 2880 True 4981 4981 97.885 3 2882 1 chr1B.!!$R1 2879
3 TraesCS2B01G301700 chr2A 374484313 374487194 2881 False 4940 4940 97.609 1 2882 1 chr2A.!!$F3 2881
4 TraesCS2B01G301700 chr2A 628570443 628573325 2882 False 4929 4929 97.540 1 2882 1 chr2A.!!$F4 2881
5 TraesCS2B01G301700 chr2A 628644693 628647576 2883 True 4926 4926 97.505 1 2882 1 chr2A.!!$R1 2881
6 TraesCS2B01G301700 chr2A 161527508 161530385 2877 False 4859 4859 97.124 1 2882 1 chr2A.!!$F1 2881
7 TraesCS2B01G301700 chr1A 409609870 409612755 2885 False 4905 4905 97.368 1 2882 1 chr1A.!!$F1 2881
8 TraesCS2B01G301700 chr7D 474677584 474680469 2885 False 4844 4844 96.990 1 2882 1 chr7D.!!$F1 2881
9 TraesCS2B01G301700 chr6A 610981354 610983515 2161 False 3670 3670 97.320 723 2882 1 chr6A.!!$F1 2159

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
227 228 3.382083 AGCGGTTCCCAATCCTAAAAT 57.618 42.857 0.0 0.0 0.0 1.82 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2187 2201 0.107456 AGGGACAAGGCATCATAGCG 59.893 55.0 0.0 0.0 34.64 4.26 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
227 228 3.382083 AGCGGTTCCCAATCCTAAAAT 57.618 42.857 0.00 0.0 0.00 1.82
239 240 5.490159 CAATCCTAAAATTGGGCACACATT 58.510 37.500 0.00 0.0 33.80 2.71
260 261 7.169982 CACATTATCGAATAGAGAACCAAGTCC 59.830 40.741 0.00 0.0 32.32 3.85
299 300 5.180117 GCGGCAATCTTACATAACATCATCT 59.820 40.000 0.00 0.0 0.00 2.90
321 322 5.046087 TCTGATCTGAAAAAGGAGATGAGCA 60.046 40.000 0.00 0.0 31.94 4.26
730 736 7.761038 ATTTCTCTTGTCGGGACTTTATTTT 57.239 32.000 0.00 0.0 0.00 1.82
799 805 6.660521 ACAATGTGGAAATGCAGAAGATAGAA 59.339 34.615 0.00 0.0 0.00 2.10
802 808 6.182627 TGTGGAAATGCAGAAGATAGAACAT 58.817 36.000 0.00 0.0 0.00 2.71
845 851 3.777106 AGATCTTGTGGACTTGCTTCA 57.223 42.857 0.00 0.0 0.00 3.02
1031 1037 2.170607 AGATAAGGAAGCAAAGCGGCTA 59.829 45.455 1.35 0.0 45.07 3.93
1153 1159 9.123902 TCATTACTTGTTGCATGCTCTAATATT 57.876 29.630 20.33 0.0 0.00 1.28
1809 1820 2.534042 TCCGAGTCTTCAAGATCCCT 57.466 50.000 0.00 0.0 0.00 4.20
1917 1928 7.610305 TCCTCTTTTCAATTAGTCCATGTTACC 59.390 37.037 0.00 0.0 0.00 2.85
2153 2167 6.546428 TGTAGCTAGTCTAGGCTGATTTTT 57.454 37.500 7.24 0.0 39.31 1.94
2464 2478 5.480422 TGGAAGGCTTCATATCTATTCGCTA 59.520 40.000 27.17 0.0 0.00 4.26
2523 2537 9.754382 AAACACTATTTCTAAAACGACTGACTA 57.246 29.630 0.00 0.0 0.00 2.59
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
123 124 1.827245 GCTCCCTGTGATTTTGGGGTT 60.827 52.381 0.00 0.00 41.22 4.11
227 228 5.029807 TCTATTCGATAATGTGTGCCCAA 57.970 39.130 0.00 0.00 0.00 4.12
235 236 7.147724 TGGACTTGGTTCTCTATTCGATAATGT 60.148 37.037 0.00 0.00 0.00 2.71
239 240 5.221263 GCTGGACTTGGTTCTCTATTCGATA 60.221 44.000 0.00 0.00 0.00 2.92
299 300 5.169992 TGCTCATCTCCTTTTTCAGATCA 57.830 39.130 0.00 0.00 0.00 2.92
368 369 5.394738 AGGAATATCACCGTCAGGAAGATA 58.605 41.667 0.00 0.00 39.94 1.98
418 420 4.264253 CAATGGCATCTCTAAGGTTGTCA 58.736 43.478 0.00 0.00 0.00 3.58
622 628 1.899142 GGAGGTGATGCTCTATCCCTC 59.101 57.143 12.28 12.28 44.35 4.30
799 805 2.756760 CAAGGCTTGCATTCCACTATGT 59.243 45.455 15.25 0.00 0.00 2.29
802 808 2.305635 TCTCAAGGCTTGCATTCCACTA 59.694 45.455 22.31 0.85 0.00 2.74
845 851 4.492494 TGTTCAGGTGTATCATGCTCAT 57.508 40.909 0.00 0.00 0.00 2.90
1030 1036 1.331399 TGCCGGTCGTCCCATGAATA 61.331 55.000 1.90 0.00 0.00 1.75
1031 1037 2.189521 GCCGGTCGTCCCATGAAT 59.810 61.111 1.90 0.00 0.00 2.57
1153 1159 9.990360 TGTGACTACATAGTTGACAAGAAAATA 57.010 29.630 0.00 0.00 36.50 1.40
1660 1667 3.054361 ACCTGCTTCGTCCTTATTTCCAT 60.054 43.478 0.00 0.00 0.00 3.41
1809 1820 5.047021 ACTCATGAAAATCTCTCGGTTCTCA 60.047 40.000 0.00 0.00 0.00 3.27
1917 1928 4.702131 ACTAAATGGCTAGCAAGGAGTTTG 59.298 41.667 18.24 6.27 39.88 2.93
2153 2167 8.902540 ATAGACAATGACTACAACAACAAGAA 57.097 30.769 0.00 0.00 0.00 2.52
2154 2168 8.902540 AATAGACAATGACTACAACAACAAGA 57.097 30.769 0.00 0.00 0.00 3.02
2187 2201 0.107456 AGGGACAAGGCATCATAGCG 59.893 55.000 0.00 0.00 34.64 4.26
2464 2478 9.747898 TCTACAAATATTACATGGACAAAACCT 57.252 29.630 0.00 0.00 0.00 3.50
2510 2524 5.339008 TCCATGCTATAGTCAGTCGTTTT 57.661 39.130 0.84 0.00 0.00 2.43
2523 2537 4.168675 TCCTCCCAAATTCTTCCATGCTAT 59.831 41.667 0.00 0.00 0.00 2.97
2687 2701 6.648310 CAGACTGAAGTGACAATAACACTGAT 59.352 38.462 0.00 0.00 46.01 2.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.