Multiple sequence alignment - TraesCS2B01G293200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G293200 chr2B 100.000 2904 0 0 1 2904 408600243 408597340 0.000000e+00 5363
1 TraesCS2B01G293200 chr2B 98.188 2373 24 6 549 2904 172273898 172276268 0.000000e+00 4126
2 TraesCS2B01G293200 chr2B 98.799 333 4 0 224 556 172273185 172273517 6.930000e-166 593
3 TraesCS2B01G293200 chr2A 98.557 2356 21 2 549 2904 465591568 465593910 0.000000e+00 4150
4 TraesCS2B01G293200 chr2A 98.143 1562 15 3 1344 2904 115734683 115736231 0.000000e+00 2712
5 TraesCS2B01G293200 chr2A 98.799 333 4 0 224 556 465590855 465591187 6.930000e-166 593
6 TraesCS2B01G293200 chr2A 99.554 224 1 0 1 224 465590032 465590255 2.690000e-110 409
7 TraesCS2B01G293200 chr1B 98.679 2346 19 1 559 2904 239785228 239782895 0.000000e+00 4150
8 TraesCS2B01G293200 chr7A 98.557 2356 18 3 549 2904 327159643 327161982 0.000000e+00 4148
9 TraesCS2B01G293200 chr7A 94.076 1266 43 17 813 2075 285682453 285683689 0.000000e+00 1893
10 TraesCS2B01G293200 chr7A 94.895 666 29 3 1413 2075 712137649 712136986 0.000000e+00 1037
11 TraesCS2B01G293200 chr7A 99.099 333 3 0 224 556 210116963 210116631 1.490000e-167 599
12 TraesCS2B01G293200 chr7A 98.799 333 4 0 224 556 327158930 327159262 6.930000e-166 593
13 TraesCS2B01G293200 chr7A 99.554 224 1 0 1 224 210117786 210117563 2.690000e-110 409
14 TraesCS2B01G293200 chr7A 99.554 224 1 0 1 224 327158107 327158330 2.690000e-110 409
15 TraesCS2B01G293200 chrUn 97.750 2356 26 4 549 2904 64800469 64798141 0.000000e+00 4032
16 TraesCS2B01G293200 chr1A 98.682 2277 17 2 629 2904 50622700 50624964 0.000000e+00 4026
17 TraesCS2B01G293200 chr1A 94.469 669 33 2 1410 2075 39979324 39978657 0.000000e+00 1027
18 TraesCS2B01G293200 chr1A 99.554 224 1 0 1 224 50621929 50622152 2.690000e-110 409
19 TraesCS2B01G293200 chr3B 97.778 2295 21 1 640 2904 475591420 475589126 0.000000e+00 3928
20 TraesCS2B01G293200 chr3B 97.250 1527 39 3 549 2075 346701627 346703150 0.000000e+00 2584
21 TraesCS2B01G293200 chr3B 99.423 1386 8 0 1519 2904 4991360 4989975 0.000000e+00 2516
22 TraesCS2B01G293200 chr3B 98.799 333 4 0 224 556 346700914 346701246 6.930000e-166 593
23 TraesCS2B01G293200 chr3B 99.554 224 1 0 1 224 4992507 4992284 2.690000e-110 409
24 TraesCS2B01G293200 chr3A 99.096 1992 18 0 913 2904 141700189 141698198 0.000000e+00 3579
25 TraesCS2B01G293200 chr3A 98.799 333 4 0 224 556 141701023 141700691 6.930000e-166 593
26 TraesCS2B01G293200 chr4B 98.823 1529 15 3 547 2075 436124058 436125583 0.000000e+00 2721
27 TraesCS2B01G293200 chr5B 98.079 1562 16 3 1344 2904 652326465 652328013 0.000000e+00 2706
28 TraesCS2B01G293200 chr5B 98.799 333 4 0 224 556 652324898 652325230 6.930000e-166 593
29 TraesCS2B01G293200 chr5B 99.552 223 1 0 2 224 433505482 433505704 9.690000e-110 407
30 TraesCS2B01G293200 chr5B 99.107 224 2 0 1 224 652324075 652324298 1.250000e-108 403
31 TraesCS2B01G293200 chr4D 95.743 1527 49 9 549 2075 472772441 472773951 0.000000e+00 2446
32 TraesCS2B01G293200 chr4A 96.273 1127 37 3 952 2075 423339181 423338057 0.000000e+00 1844
33 TraesCS2B01G293200 chr5A 99.099 333 3 0 224 556 92668208 92668540 1.490000e-167 599
34 TraesCS2B01G293200 chr5A 99.554 224 1 0 1 224 92667385 92667608 2.690000e-110 409
35 TraesCS2B01G293200 chr2D 98.799 333 4 0 224 556 334210454 334210122 6.930000e-166 593
36 TraesCS2B01G293200 chr6B 99.554 224 1 0 1 224 179765904 179766127 2.690000e-110 409


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G293200 chr2B 408597340 408600243 2903 True 5363.000000 5363 100.000000 1 2904 1 chr2B.!!$R1 2903
1 TraesCS2B01G293200 chr2B 172273185 172276268 3083 False 2359.500000 4126 98.493500 224 2904 2 chr2B.!!$F1 2680
2 TraesCS2B01G293200 chr2A 115734683 115736231 1548 False 2712.000000 2712 98.143000 1344 2904 1 chr2A.!!$F1 1560
3 TraesCS2B01G293200 chr2A 465590032 465593910 3878 False 1717.333333 4150 98.970000 1 2904 3 chr2A.!!$F2 2903
4 TraesCS2B01G293200 chr1B 239782895 239785228 2333 True 4150.000000 4150 98.679000 559 2904 1 chr1B.!!$R1 2345
5 TraesCS2B01G293200 chr7A 285682453 285683689 1236 False 1893.000000 1893 94.076000 813 2075 1 chr7A.!!$F1 1262
6 TraesCS2B01G293200 chr7A 327158107 327161982 3875 False 1716.666667 4148 98.970000 1 2904 3 chr7A.!!$F2 2903
7 TraesCS2B01G293200 chr7A 712136986 712137649 663 True 1037.000000 1037 94.895000 1413 2075 1 chr7A.!!$R1 662
8 TraesCS2B01G293200 chr7A 210116631 210117786 1155 True 504.000000 599 99.326500 1 556 2 chr7A.!!$R2 555
9 TraesCS2B01G293200 chrUn 64798141 64800469 2328 True 4032.000000 4032 97.750000 549 2904 1 chrUn.!!$R1 2355
10 TraesCS2B01G293200 chr1A 50621929 50624964 3035 False 2217.500000 4026 99.118000 1 2904 2 chr1A.!!$F1 2903
11 TraesCS2B01G293200 chr1A 39978657 39979324 667 True 1027.000000 1027 94.469000 1410 2075 1 chr1A.!!$R1 665
12 TraesCS2B01G293200 chr3B 475589126 475591420 2294 True 3928.000000 3928 97.778000 640 2904 1 chr3B.!!$R1 2264
13 TraesCS2B01G293200 chr3B 346700914 346703150 2236 False 1588.500000 2584 98.024500 224 2075 2 chr3B.!!$F1 1851
14 TraesCS2B01G293200 chr3B 4989975 4992507 2532 True 1462.500000 2516 99.488500 1 2904 2 chr3B.!!$R2 2903
15 TraesCS2B01G293200 chr3A 141698198 141701023 2825 True 2086.000000 3579 98.947500 224 2904 2 chr3A.!!$R1 2680
16 TraesCS2B01G293200 chr4B 436124058 436125583 1525 False 2721.000000 2721 98.823000 547 2075 1 chr4B.!!$F1 1528
17 TraesCS2B01G293200 chr5B 652324075 652328013 3938 False 1234.000000 2706 98.661667 1 2904 3 chr5B.!!$F2 2903
18 TraesCS2B01G293200 chr4D 472772441 472773951 1510 False 2446.000000 2446 95.743000 549 2075 1 chr4D.!!$F1 1526
19 TraesCS2B01G293200 chr4A 423338057 423339181 1124 True 1844.000000 1844 96.273000 952 2075 1 chr4A.!!$R1 1123
20 TraesCS2B01G293200 chr5A 92667385 92668540 1155 False 504.000000 599 99.326500 1 556 2 chr5A.!!$F1 555

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
142 143 1.509373 ATGATTGAGGAGGCTGAGCT 58.491 50.000 3.72 0.0 0.0 4.09 F
1159 2148 2.387757 AGCCAGCAAGTGAAGGAAAAA 58.612 42.857 0.00 0.0 0.0 1.94 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1657 2873 0.311790 GAGATGCTCCTCTCTCTGCG 59.688 60.000 4.81 0.0 38.9 5.18 R
2654 3872 1.224592 CCCGAGGCACCAGCTAATT 59.775 57.895 0.00 0.0 41.7 1.40 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
142 143 1.509373 ATGATTGAGGAGGCTGAGCT 58.491 50.000 3.72 0.0 0.00 4.09
415 1016 6.351456 GCTAAGAGGAAAGTGGTATGAGAAGT 60.351 42.308 0.00 0.0 0.00 3.01
522 1123 4.941873 GCTACTGCACTAAATGGTAGGTTT 59.058 41.667 8.56 0.0 39.41 3.27
591 1579 5.121611 TGACTATGTCAATAACAACCTTGCG 59.878 40.000 0.00 0.0 42.37 4.85
663 1651 4.922206 ACTTGTTGGATAAGATCAGGCAA 58.078 39.130 0.00 0.0 0.00 4.52
1159 2148 2.387757 AGCCAGCAAGTGAAGGAAAAA 58.612 42.857 0.00 0.0 0.00 1.94
1379 2371 2.744768 GAAGCTCCAGTGCAGCCTGT 62.745 60.000 1.34 0.0 37.63 4.00
1657 2873 5.126779 CCAAGGAAGAACTATAAGAAGGCC 58.873 45.833 0.00 0.0 0.00 5.19
2732 3950 2.229062 CGAGTCTGCCAAGTAGAACTCA 59.771 50.000 0.00 0.0 30.20 3.41
2738 3956 3.431415 TGCCAAGTAGAACTCAGAGCTA 58.569 45.455 0.00 0.0 0.00 3.32
2815 4033 3.117131 CCCCCAAATCTAGCAAACCCTAT 60.117 47.826 0.00 0.0 0.00 2.57
2883 4101 2.281517 GAGAGTTCTCCGACGAGATGA 58.718 52.381 0.00 0.0 44.68 2.92
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
142 143 2.767960 TCTGAGCCTAGCACATCATCAA 59.232 45.455 0.00 0.00 0.00 2.57
403 1004 7.672660 TCTCCTAAAACACTACTTCTCATACCA 59.327 37.037 0.00 0.00 0.00 3.25
415 1016 8.044908 ACTGACAAAAACTCTCCTAAAACACTA 58.955 33.333 0.00 0.00 0.00 2.74
522 1123 1.270839 GCAGCAACCAACTGACCTCTA 60.271 52.381 0.00 0.00 37.32 2.43
663 1651 9.382275 CTAAGGCCAAATTTTTGCATTAAGTAT 57.618 29.630 5.01 0.00 36.86 2.12
1159 2148 4.405756 TTCTCTTCCTAGGACCAAGTCT 57.594 45.455 12.22 0.00 32.47 3.24
1379 2371 3.196469 CACTGGAGCTTCATCTTCACCTA 59.804 47.826 0.00 0.00 0.00 3.08
1657 2873 0.311790 GAGATGCTCCTCTCTCTGCG 59.688 60.000 4.81 0.00 38.90 5.18
2654 3872 1.224592 CCCGAGGCACCAGCTAATT 59.775 57.895 0.00 0.00 41.70 1.40
2732 3950 2.092538 AGGCATTGTTCAGCATAGCTCT 60.093 45.455 0.00 0.00 36.40 4.09
2738 3956 1.686115 GGGGTAGGCATTGTTCAGCAT 60.686 52.381 0.00 0.00 0.00 3.79
2815 4033 2.239654 CTCATCTGGTCCCCTGCTTTTA 59.760 50.000 0.00 0.00 0.00 1.52
2883 4101 2.564975 GACCATGTCGACGTCGGT 59.435 61.111 35.05 24.81 40.29 4.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.