Multiple sequence alignment - TraesCS2B01G285100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G285100 chr2B 100.000 3096 0 0 1 3096 392650104 392653199 0.000000e+00 5718.0
1 TraesCS2B01G285100 chr2B 99.451 3097 16 1 1 3096 392616562 392619658 0.000000e+00 5624.0
2 TraesCS2B01G285100 chr2B 99.296 426 2 1 1 425 61603893 61604318 0.000000e+00 769.0
3 TraesCS2B01G285100 chr2B 97.907 430 8 1 1 429 455584047 455583618 0.000000e+00 743.0
4 TraesCS2B01G285100 chr2D 95.000 1620 67 6 558 2164 324044743 324046361 0.000000e+00 2531.0
5 TraesCS2B01G285100 chr2D 96.552 58 2 0 3036 3093 324048164 324048221 2.540000e-16 97.1
6 TraesCS2B01G285100 chr4B 91.353 798 52 7 2171 2953 132554944 132554149 0.000000e+00 1075.0
7 TraesCS2B01G285100 chr4B 98.592 426 5 1 1 425 5010728 5011153 0.000000e+00 752.0
8 TraesCS2B01G285100 chr7D 90.727 798 64 9 2169 2958 607056350 607055555 0.000000e+00 1055.0
9 TraesCS2B01G285100 chr7D 90.657 792 68 6 2169 2957 190131784 190130996 0.000000e+00 1048.0
10 TraesCS2B01G285100 chr4D 89.401 802 74 9 2161 2956 8413978 8414774 0.000000e+00 1000.0
11 TraesCS2B01G285100 chr4D 92.727 55 4 0 2028 2082 498952410 498952464 2.560000e-11 80.5
12 TraesCS2B01G285100 chr3D 89.541 784 69 10 2169 2947 15282491 15281716 0.000000e+00 981.0
13 TraesCS2B01G285100 chr3D 89.386 782 74 9 2169 2946 378772795 378773571 0.000000e+00 976.0
14 TraesCS2B01G285100 chr3D 88.764 801 75 11 2169 2957 303517204 303518001 0.000000e+00 966.0
15 TraesCS2B01G285100 chr6A 89.286 784 74 9 2169 2946 28316190 28315411 0.000000e+00 974.0
16 TraesCS2B01G285100 chr4A 86.853 753 89 9 2161 2909 324655452 324656198 0.000000e+00 833.0
17 TraesCS2B01G285100 chr3B 99.299 428 2 1 1 427 357772228 357771801 0.000000e+00 773.0
18 TraesCS2B01G285100 chr3B 98.592 426 5 1 1 425 676953496 676953071 0.000000e+00 752.0
19 TraesCS2B01G285100 chr3A 98.845 433 2 2 1 432 691290842 691290412 0.000000e+00 769.0
20 TraesCS2B01G285100 chr6B 99.061 426 2 2 1 424 545467278 545466853 0.000000e+00 763.0
21 TraesCS2B01G285100 chr7A 98.353 425 6 1 1 424 548068447 548068871 0.000000e+00 745.0
22 TraesCS2B01G285100 chr5A 92.727 55 4 0 2028 2082 679742387 679742441 2.560000e-11 80.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G285100 chr2B 392650104 392653199 3095 False 5718.00 5718 100.000 1 3096 1 chr2B.!!$F3 3095
1 TraesCS2B01G285100 chr2B 392616562 392619658 3096 False 5624.00 5624 99.451 1 3096 1 chr2B.!!$F2 3095
2 TraesCS2B01G285100 chr2D 324044743 324048221 3478 False 1314.05 2531 95.776 558 3093 2 chr2D.!!$F1 2535
3 TraesCS2B01G285100 chr4B 132554149 132554944 795 True 1075.00 1075 91.353 2171 2953 1 chr4B.!!$R1 782
4 TraesCS2B01G285100 chr7D 607055555 607056350 795 True 1055.00 1055 90.727 2169 2958 1 chr7D.!!$R2 789
5 TraesCS2B01G285100 chr7D 190130996 190131784 788 True 1048.00 1048 90.657 2169 2957 1 chr7D.!!$R1 788
6 TraesCS2B01G285100 chr4D 8413978 8414774 796 False 1000.00 1000 89.401 2161 2956 1 chr4D.!!$F1 795
7 TraesCS2B01G285100 chr3D 15281716 15282491 775 True 981.00 981 89.541 2169 2947 1 chr3D.!!$R1 778
8 TraesCS2B01G285100 chr3D 378772795 378773571 776 False 976.00 976 89.386 2169 2946 1 chr3D.!!$F2 777
9 TraesCS2B01G285100 chr3D 303517204 303518001 797 False 966.00 966 88.764 2169 2957 1 chr3D.!!$F1 788
10 TraesCS2B01G285100 chr6A 28315411 28316190 779 True 974.00 974 89.286 2169 2946 1 chr6A.!!$R1 777
11 TraesCS2B01G285100 chr4A 324655452 324656198 746 False 833.00 833 86.853 2161 2909 1 chr4A.!!$F1 748

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
76 77 0.033504 AGGTCGGTGCAACAGTACAG 59.966 55.0 0.98 0.0 39.98 2.74 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2888 2937 0.677842 CCCACCTACACGCCCTATAC 59.322 60.0 0.0 0.0 0.0 1.47 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
76 77 0.033504 AGGTCGGTGCAACAGTACAG 59.966 55.000 0.98 0.00 39.98 2.74
151 152 2.175184 CTTGGTTGAGAAGCACGCCG 62.175 60.000 0.00 0.00 38.84 6.46
261 262 3.435186 GCCCAGACTTTCAGCGCC 61.435 66.667 2.29 0.00 0.00 6.53
395 396 3.472943 ATCGCCCAGATGCAGAGGC 62.473 63.158 8.59 8.59 42.18 4.70
2888 2937 4.537965 GTGACATGGCGTAGTCTGTATAG 58.462 47.826 0.00 0.00 35.81 1.31
2904 2953 5.013495 TCTGTATAGTATAGGGCGTGTAGGT 59.987 44.000 0.00 0.00 0.00 3.08
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
76 77 2.295885 CCACCAATCCATCTTCAGAGC 58.704 52.381 0.00 0.00 0.00 4.09
261 262 3.587498 TCCCTATCCAGTTGATGTAGGG 58.413 50.000 9.06 9.06 45.47 3.53
395 396 2.517484 GAAAAGGAGGACGACCCCGG 62.517 65.000 0.00 0.00 40.78 5.73
440 441 7.152645 TGTTTCAGTAGGTTAGTCTGTGATTC 58.847 38.462 0.00 0.00 0.00 2.52
505 506 6.907853 TCCATCACATTGTAAATCCACAAA 57.092 33.333 0.00 0.00 41.50 2.83
2888 2937 0.677842 CCCACCTACACGCCCTATAC 59.322 60.000 0.00 0.00 0.00 1.47
3062 4820 7.255381 GCTAGCAATGTTTGATCCATCTTGTAT 60.255 37.037 10.63 0.00 0.00 2.29


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.