Multiple sequence alignment - TraesCS2B01G283900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G283900 chr2B 100.000 3393 0 0 1 3393 391172730 391169338 0 6266
1 TraesCS2B01G283900 chr7A 98.850 3392 38 1 1 3391 60349346 60345955 0 6047
2 TraesCS2B01G283900 chr7B 98.763 3394 40 2 1 3393 716910711 716907319 0 6034
3 TraesCS2B01G283900 chr7B 98.763 3394 39 2 1 3393 742954452 742957843 0 6032
4 TraesCS2B01G283900 chr7B 98.615 3394 44 3 1 3393 716778894 716775503 0 6004
5 TraesCS2B01G283900 chr5A 98.763 3394 40 2 1 3393 16538868 16535476 0 6034


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G283900 chr2B 391169338 391172730 3392 True 6266 6266 100.000 1 3393 1 chr2B.!!$R1 3392
1 TraesCS2B01G283900 chr7A 60345955 60349346 3391 True 6047 6047 98.850 1 3391 1 chr7A.!!$R1 3390
2 TraesCS2B01G283900 chr7B 716907319 716910711 3392 True 6034 6034 98.763 1 3393 1 chr7B.!!$R2 3392
3 TraesCS2B01G283900 chr7B 742954452 742957843 3391 False 6032 6032 98.763 1 3393 1 chr7B.!!$F1 3392
4 TraesCS2B01G283900 chr7B 716775503 716778894 3391 True 6004 6004 98.615 1 3393 1 chr7B.!!$R1 3392
5 TraesCS2B01G283900 chr5A 16535476 16538868 3392 True 6034 6034 98.763 1 3393 1 chr5A.!!$R1 3392

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
133 134 1.446907 AAGTCGAAGCATGCCAGAAG 58.553 50.000 15.66 1.82 0.0 2.85 F
507 508 2.897969 AGCCTCGTCTCCTTTAACTGAA 59.102 45.455 0.00 0.00 0.0 3.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1078 1080 4.204012 CCCGCAATGAATAAGGAAGGTAA 58.796 43.478 0.0 0.0 0.0 2.85 R
2456 2459 4.716784 TGTCATTCCAGTACAGCTAATCCT 59.283 41.667 0.0 0.0 0.0 3.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
133 134 1.446907 AAGTCGAAGCATGCCAGAAG 58.553 50.000 15.66 1.82 0.00 2.85
507 508 2.897969 AGCCTCGTCTCCTTTAACTGAA 59.102 45.455 0.00 0.00 0.00 3.02
649 650 5.317808 TCCCTTACGAACATGAAAATCCAA 58.682 37.500 0.00 0.00 0.00 3.53
1078 1080 9.726438 GATACTGGGTTATTCATAGCATTACTT 57.274 33.333 0.00 0.00 0.00 2.24
1219 1221 9.695526 CTTCATTTTTCTTGGATATTCAACACA 57.304 29.630 0.00 0.00 0.00 3.72
1357 1359 6.112734 TGATACGCTGTTTGGATTAGATGTT 58.887 36.000 0.00 0.00 0.00 2.71
1380 1382 6.854496 TGCAATATCGGTTGTAGTATTTCC 57.146 37.500 0.00 0.00 0.00 3.13
1739 1741 2.222530 GCTAGTTGACTAACGCTTTCGC 60.223 50.000 0.00 0.00 41.71 4.70
2146 2149 2.443887 GCAGCAAGAAAAGGATGCAA 57.556 45.000 0.00 0.00 45.18 4.08
2299 2302 0.625849 ATGGAAGTCCTCGGCCAAAT 59.374 50.000 2.24 0.00 36.82 2.32
2456 2459 4.242475 CAGTACGATGGTTAGCTGTTCAA 58.758 43.478 0.00 0.00 0.00 2.69
2577 2580 2.865119 TGACAGCAATCATGACAGGT 57.135 45.000 0.00 0.00 0.00 4.00
2649 2652 4.395231 ACAACTAATAAAGCTCCGCCTTTC 59.605 41.667 0.00 0.00 36.50 2.62
2780 2783 8.043113 ACAGACTGCAAAAGATAGATACAATGA 58.957 33.333 1.25 0.00 0.00 2.57
2959 2962 6.325919 TCAATTGACAAAGCGTCCTATTTT 57.674 33.333 3.38 0.00 44.71 1.82
3009 3012 5.521735 GTGAAGACGAATTGCTATCATCTGT 59.478 40.000 0.00 0.00 0.00 3.41
3081 3084 6.471198 TCACTATTGACTTACGAGTTTATGCG 59.529 38.462 0.00 0.00 35.88 4.73
3133 3136 2.350522 GTAGGCTGGTTGTGAGACATG 58.649 52.381 0.00 0.00 0.00 3.21
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
133 134 3.233684 ACGGCTCACTACTAAAGAAGC 57.766 47.619 0.00 0.0 37.04 3.86
303 304 5.884792 CAGGCTCATAAAGAGGATGAAACTT 59.115 40.000 0.00 0.0 44.86 2.66
649 650 2.568509 CAAAGCCTTCCAAACCATCCAT 59.431 45.455 0.00 0.0 0.00 3.41
1078 1080 4.204012 CCCGCAATGAATAAGGAAGGTAA 58.796 43.478 0.00 0.0 0.00 2.85
1357 1359 5.464057 CGGAAATACTACAACCGATATTGCA 59.536 40.000 0.00 0.0 45.31 4.08
1380 1382 7.197071 TCTCTCTTAGCTTATAGAAAGAGCG 57.803 40.000 14.33 10.0 42.96 5.03
1755 1757 9.547753 GGTTGTAGATAATGCTCTATGAAAGAA 57.452 33.333 0.00 0.0 32.46 2.52
1761 1763 6.997655 TCAGGGTTGTAGATAATGCTCTATG 58.002 40.000 0.00 0.0 30.75 2.23
2056 2058 9.772973 TCAAGCAATAGTCAAGAGTTACTAAAA 57.227 29.630 0.00 0.0 32.24 1.52
2146 2149 5.393027 GCATATCCGATTTTTGGACACTTGT 60.393 40.000 0.00 0.0 38.60 3.16
2456 2459 4.716784 TGTCATTCCAGTACAGCTAATCCT 59.283 41.667 0.00 0.0 0.00 3.24
2649 2652 3.004524 GCCTATCTGTTGTAGTAGTCCCG 59.995 52.174 0.00 0.0 0.00 5.14
2780 2783 1.113788 GCATGCATGGTGGGTAACAT 58.886 50.000 27.34 0.0 39.74 2.71
2959 2962 9.263538 CTAAGAGCTAACGACTAGAAATCTAGA 57.736 37.037 21.24 0.0 46.80 2.43
3081 3084 3.664107 TGCCGATATAGGAATGAAGCAC 58.336 45.455 5.98 0.0 0.00 4.40
3133 3136 4.095036 GCCATTTGTAGCACTAAGAGGAAC 59.905 45.833 0.00 0.0 0.00 3.62


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.