Multiple sequence alignment - TraesCS2B01G283700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G283700 chr2B 100.000 2231 0 0 1 2231 391162678 391164908 0 4120
1 TraesCS2B01G283700 chrUn 98.611 2232 30 1 1 2231 186206752 186204521 0 3949
2 TraesCS2B01G283700 chr7B 98.566 2232 31 1 1 2231 716877112 716874881 0 3943
3 TraesCS2B01G283700 chr7B 98.522 2232 32 1 1 2231 742991114 742993345 0 3938
4 TraesCS2B01G283700 chr7B 97.987 2236 40 2 1 2231 716836901 716834666 0 3875
5 TraesCS2B01G283700 chr7A 98.566 2231 32 0 1 2231 60280982 60283212 0 3943
6 TraesCS2B01G283700 chr1A 98.566 2231 32 0 1 2231 498689558 498687328 0 3943
7 TraesCS2B01G283700 chr5A 97.987 2236 39 2 1 2231 238821139 238818905 0 3875
8 TraesCS2B01G283700 chr7D 98.496 2194 27 2 1 2189 382051748 382053940 0 3864
9 TraesCS2B01G283700 chr3A 97.627 2233 48 1 1 2228 725798417 725800649 0 3825


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G283700 chr2B 391162678 391164908 2230 False 4120 4120 100.000 1 2231 1 chr2B.!!$F1 2230
1 TraesCS2B01G283700 chrUn 186204521 186206752 2231 True 3949 3949 98.611 1 2231 1 chrUn.!!$R1 2230
2 TraesCS2B01G283700 chr7B 716874881 716877112 2231 True 3943 3943 98.566 1 2231 1 chr7B.!!$R2 2230
3 TraesCS2B01G283700 chr7B 742991114 742993345 2231 False 3938 3938 98.522 1 2231 1 chr7B.!!$F1 2230
4 TraesCS2B01G283700 chr7B 716834666 716836901 2235 True 3875 3875 97.987 1 2231 1 chr7B.!!$R1 2230
5 TraesCS2B01G283700 chr7A 60280982 60283212 2230 False 3943 3943 98.566 1 2231 1 chr7A.!!$F1 2230
6 TraesCS2B01G283700 chr1A 498687328 498689558 2230 True 3943 3943 98.566 1 2231 1 chr1A.!!$R1 2230
7 TraesCS2B01G283700 chr5A 238818905 238821139 2234 True 3875 3875 97.987 1 2231 1 chr5A.!!$R1 2230
8 TraesCS2B01G283700 chr7D 382051748 382053940 2192 False 3864 3864 98.496 1 2189 1 chr7D.!!$F1 2188
9 TraesCS2B01G283700 chr3A 725798417 725800649 2232 False 3825 3825 97.627 1 2228 1 chr3A.!!$F1 2227

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
244 245 0.965439 CTCATTTGGGGCGGAAAACA 59.035 50.0 0.0 0.0 0.0 2.83 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1977 1989 0.03759 ATGGGCAAACGCACCTAAGA 59.962 50.0 0.0 0.0 42.14 2.1 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
50 51 4.461431 TGTACGAGTCCACAATCACTACAT 59.539 41.667 0.00 0.00 0.00 2.29
244 245 0.965439 CTCATTTGGGGCGGAAAACA 59.035 50.000 0.00 0.00 0.00 2.83
257 258 3.120338 GCGGAAAACAAATCGACATCTCA 60.120 43.478 0.00 0.00 0.00 3.27
1573 1583 3.157087 ACAAAGGCGAAGACAATTCCAT 58.843 40.909 0.00 0.00 39.87 3.41
1869 1881 1.304052 CCTTGCCGTTTCCCCATCA 60.304 57.895 0.00 0.00 0.00 3.07
1887 1899 4.219070 CCATCAGCTGAAGTTGGATCAAAA 59.781 41.667 24.70 0.00 0.00 2.44
1889 1901 6.395629 CATCAGCTGAAGTTGGATCAAAATT 58.604 36.000 22.50 0.00 0.00 1.82
1892 1904 5.047519 CAGCTGAAGTTGGATCAAAATTCCT 60.048 40.000 17.97 7.94 34.17 3.36
1956 1968 1.298953 AACAGGCACCCCATCACTAT 58.701 50.000 0.00 0.00 0.00 2.12
1957 1969 1.298953 ACAGGCACCCCATCACTATT 58.701 50.000 0.00 0.00 0.00 1.73
2028 2040 3.190327 CCATCTACGCGATTCTGAGATCT 59.810 47.826 15.93 0.00 0.00 2.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
50 51 1.780309 ACCAAACCCAGGTTCATCTCA 59.220 47.619 1.78 0.00 35.33 3.27
244 245 7.201644 GGTTGTATCACATTGAGATGTCGATTT 60.202 37.037 6.82 0.00 44.55 2.17
257 258 6.933514 AAATGGAAAGGGTTGTATCACATT 57.066 33.333 0.00 0.00 0.00 2.71
556 557 9.263538 CTTTGAATCAAAGGTTTCATGAAATCA 57.736 29.630 28.55 19.43 44.75 2.57
615 620 0.396556 TGCCATCCATTGCAGCAGAT 60.397 50.000 0.00 0.00 32.77 2.90
1869 1881 5.047519 CAGGAATTTTGATCCAACTTCAGCT 60.048 40.000 10.52 0.00 39.55 4.24
1887 1899 0.811616 GAGCATTCGCGTCCAGGAAT 60.812 55.000 5.77 0.00 45.49 3.01
1889 1901 1.960040 ATGAGCATTCGCGTCCAGGA 61.960 55.000 5.77 0.00 45.49 3.86
1892 1904 2.238942 ATAATGAGCATTCGCGTCCA 57.761 45.000 5.77 0.00 45.49 4.02
1977 1989 0.037590 ATGGGCAAACGCACCTAAGA 59.962 50.000 0.00 0.00 42.14 2.10
2028 2040 3.389329 GGATCTCTCAGTTCCAATGGCTA 59.611 47.826 0.00 0.00 34.85 3.93


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.