Multiple sequence alignment - TraesCS2B01G283200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G283200 chr2B 100.000 2255 0 0 1 2255 391114652 391112398 0 4165
1 TraesCS2B01G283200 chr1D 98.584 2260 25 4 1 2255 141314951 141312694 0 3989
2 TraesCS2B01G283200 chr7B 98.496 2261 27 4 1 2255 644465627 644467886 0 3980
3 TraesCS2B01G283200 chr7A 98.451 2260 29 3 1 2255 60150103 60147845 0 3975
4 TraesCS2B01G283200 chr3A 98.407 2260 30 3 1 2255 633109438 633111696 0 3969
5 TraesCS2B01G283200 chr1B 98.142 2260 36 3 1 2255 672477345 672479603 0 3936
6 TraesCS2B01G283200 chr1B 98.098 2261 35 5 1 2255 638702482 638700224 0 3930
7 TraesCS2B01G283200 chr6B 98.053 2260 38 3 1 2255 306997806 306995548 0 3925


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G283200 chr2B 391112398 391114652 2254 True 4165 4165 100.000 1 2255 1 chr2B.!!$R1 2254
1 TraesCS2B01G283200 chr1D 141312694 141314951 2257 True 3989 3989 98.584 1 2255 1 chr1D.!!$R1 2254
2 TraesCS2B01G283200 chr7B 644465627 644467886 2259 False 3980 3980 98.496 1 2255 1 chr7B.!!$F1 2254
3 TraesCS2B01G283200 chr7A 60147845 60150103 2258 True 3975 3975 98.451 1 2255 1 chr7A.!!$R1 2254
4 TraesCS2B01G283200 chr3A 633109438 633111696 2258 False 3969 3969 98.407 1 2255 1 chr3A.!!$F1 2254
5 TraesCS2B01G283200 chr1B 672477345 672479603 2258 False 3936 3936 98.142 1 2255 1 chr1B.!!$F1 2254
6 TraesCS2B01G283200 chr1B 638700224 638702482 2258 True 3930 3930 98.098 1 2255 1 chr1B.!!$R1 2254
7 TraesCS2B01G283200 chr6B 306995548 306997806 2258 True 3925 3925 98.053 1 2255 1 chr6B.!!$R1 2254

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
901 903 1.464608 CGGATGATTGTCGCTTGTGTT 59.535 47.619 0.0 0.0 0.0 3.32 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1930 1937 1.456287 GCACCAACCAAGAGGAGGT 59.544 57.895 0.0 0.0 43.98 3.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
151 152 3.909995 TCCTTCATCTGAACCTTCCAAGA 59.090 43.478 0.00 0.00 0.0 3.02
236 237 2.492012 AGTAGTTGAGTCGTGTCTCGT 58.508 47.619 0.00 0.00 40.8 4.18
463 464 1.626686 TTGCAATGACGGGTGGATTT 58.373 45.000 0.00 0.00 0.0 2.17
506 507 2.066262 CGGTTATGGCGCGATAAAGAT 58.934 47.619 23.85 0.00 0.0 2.40
589 590 9.425577 GAGCTTTGTACTTGAAATTAGTAGTCT 57.574 33.333 0.00 0.00 0.0 3.24
763 764 1.931635 TTGGGGGTTCCTTATGTTGC 58.068 50.000 0.00 0.00 36.2 4.17
839 841 3.019564 CCAAAGGCTTTCTCATTCGGAT 58.980 45.455 10.08 0.00 0.0 4.18
891 893 3.464907 CATTCTCTGCTCGGATGATTGT 58.535 45.455 0.00 0.00 0.0 2.71
901 903 1.464608 CGGATGATTGTCGCTTGTGTT 59.535 47.619 0.00 0.00 0.0 3.32
1421 1423 5.997746 CCTCGTTTATGTCCATGGTATCATT 59.002 40.000 12.58 3.84 0.0 2.57
1611 1617 1.767692 GGAACCAGCAAAGGGAGGA 59.232 57.895 0.00 0.00 0.0 3.71
1893 1900 8.268850 CTGAGCTAGCTAATTTTTCCTTTACA 57.731 34.615 19.38 5.02 0.0 2.41
1908 1915 4.223032 TCCTTTACAAGATCTCGGCTCTTT 59.777 41.667 0.00 0.00 30.6 2.52
1930 1937 1.492176 GAATGATTGGAGAGAGCCCCA 59.508 52.381 0.00 0.00 0.0 4.96
1954 1961 4.974721 CTTGGTTGGTGCCGGGCT 62.975 66.667 21.46 0.00 0.0 5.19
2059 2067 1.228988 CAGGCTTTGCTCCCCCTTT 60.229 57.895 0.00 0.00 0.0 3.11
2140 2148 7.059156 CCCATAGAAAAGATCATGAAAGAGGT 58.941 38.462 0.00 0.00 0.0 3.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
151 152 8.661345 GGTCTTCCCCATAAAGATAGATTAGTT 58.339 37.037 0.00 0.00 35.35 2.24
236 237 5.707298 CCTCATTTCACTCTTTTTGCTCCTA 59.293 40.000 0.00 0.00 0.00 2.94
463 464 0.607112 CTCTCCTTGCAGCTCTGACA 59.393 55.000 0.29 0.00 0.00 3.58
506 507 2.408271 ATCCGAGCATTGAAGCAAGA 57.592 45.000 0.00 0.00 36.85 3.02
763 764 5.628606 CACAATAGACATATCTGCTCAGTCG 59.371 44.000 0.00 0.00 36.29 4.18
891 893 6.198029 CACAACAATGAAATTAACACAAGCGA 59.802 34.615 0.00 0.00 32.46 4.93
901 903 3.508012 CGGGACCCACAACAATGAAATTA 59.492 43.478 12.15 0.00 32.46 1.40
1421 1423 6.179756 TGGTTGATAGTAGAAGGTACGTACA 58.820 40.000 26.02 3.25 0.00 2.90
1611 1617 2.671396 CGTTAGCACTACGGCTTTTCAT 59.329 45.455 0.00 0.00 42.71 2.57
1893 1900 3.198635 TCATTCCAAAGAGCCGAGATCTT 59.801 43.478 0.00 0.00 40.14 2.40
1908 1915 1.492176 GGGCTCTCTCCAATCATTCCA 59.508 52.381 0.00 0.00 0.00 3.53
1930 1937 1.456287 GCACCAACCAAGAGGAGGT 59.544 57.895 0.00 0.00 43.98 3.85
1954 1961 3.280295 GAAGTAGTCCCATCACTCTCGA 58.720 50.000 0.00 0.00 0.00 4.04


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.