Multiple sequence alignment - TraesCS2B01G282800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2B01G282800 chr2B 100.000 2960 0 0 1 2960 391079891 391082850 0 5467
1 TraesCS2B01G282800 chr2B 98.108 2960 54 2 1 2959 112837997 112835039 0 5155
2 TraesCS2B01G282800 chr7B 98.784 2961 34 2 1 2959 716881820 716884780 0 5267
3 TraesCS2B01G282800 chr7A 98.717 2961 34 4 1 2959 60276274 60273316 0 5254
4 TraesCS2B01G282800 chr7A 98.615 2961 37 4 1 2959 120844191 120847149 0 5238
5 TraesCS2B01G282800 chr6D 98.547 2960 37 3 1 2959 124514491 124511537 0 5223
6 TraesCS2B01G282800 chr7D 98.480 2960 40 2 1 2959 381976795 381979750 0 5212
7 TraesCS2B01G282800 chr7D 98.412 2960 42 2 1 2959 203496966 203494011 0 5201
8 TraesCS2B01G282800 chr7D 98.345 2961 43 3 1 2959 381916945 381913989 0 5192
9 TraesCS2B01G282800 chr1B 98.446 2960 43 3 1 2959 672557172 672560129 0 5208


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2B01G282800 chr2B 391079891 391082850 2959 False 5467 5467 100.000 1 2960 1 chr2B.!!$F1 2959
1 TraesCS2B01G282800 chr2B 112835039 112837997 2958 True 5155 5155 98.108 1 2959 1 chr2B.!!$R1 2958
2 TraesCS2B01G282800 chr7B 716881820 716884780 2960 False 5267 5267 98.784 1 2959 1 chr7B.!!$F1 2958
3 TraesCS2B01G282800 chr7A 60273316 60276274 2958 True 5254 5254 98.717 1 2959 1 chr7A.!!$R1 2958
4 TraesCS2B01G282800 chr7A 120844191 120847149 2958 False 5238 5238 98.615 1 2959 1 chr7A.!!$F1 2958
5 TraesCS2B01G282800 chr6D 124511537 124514491 2954 True 5223 5223 98.547 1 2959 1 chr6D.!!$R1 2958
6 TraesCS2B01G282800 chr7D 381976795 381979750 2955 False 5212 5212 98.480 1 2959 1 chr7D.!!$F1 2958
7 TraesCS2B01G282800 chr7D 203494011 203496966 2955 True 5201 5201 98.412 1 2959 1 chr7D.!!$R1 2958
8 TraesCS2B01G282800 chr7D 381913989 381916945 2956 True 5192 5192 98.345 1 2959 1 chr7D.!!$R2 2958
9 TraesCS2B01G282800 chr1B 672557172 672560129 2957 False 5208 5208 98.446 1 2959 1 chr1B.!!$F1 2958

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
164 165 4.679639 GCGTACTTCCACATATCCACTCAA 60.68 45.833 0.0 0.0 0.0 3.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2163 2171 0.250513 AGGCTTCTGTCGGATTCACC 59.749 55.0 0.0 0.0 0.0 4.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
164 165 4.679639 GCGTACTTCCACATATCCACTCAA 60.680 45.833 0.00 0.00 0.00 3.02
409 410 6.626302 TGGACAACTTCAAATCTTCGTTTTT 58.374 32.000 0.00 0.00 0.00 1.94
1344 1351 6.426937 TGATTAATAAAGATCAGCCTAACGCC 59.573 38.462 0.00 0.00 38.78 5.68
1403 1410 9.391006 CTTACCTATGCTTAAGATGTTTGGTAA 57.609 33.333 6.67 13.62 35.74 2.85
1483 1490 2.418368 ATCATCCGCAGTTAAGGCAA 57.582 45.000 0.57 0.00 0.00 4.52
2163 2171 0.107703 TACCAAATGCTCTGGCTCGG 60.108 55.000 0.00 0.00 37.48 4.63
2340 2348 7.642669 CGTCAGCATATGAAGGTTATCAATTT 58.357 34.615 6.97 0.00 40.43 1.82
2475 2484 2.092103 ACCTCAAGCACAAAACCACCTA 60.092 45.455 0.00 0.00 0.00 3.08
2477 2486 3.573967 CCTCAAGCACAAAACCACCTATT 59.426 43.478 0.00 0.00 0.00 1.73
2959 2971 5.070823 AGGATTGTTTATGCCATCTCCAT 57.929 39.130 0.00 0.00 0.00 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
49 50 0.324943 GCTAGTCCTTGGGAACAGCA 59.675 55.000 12.76 0.00 44.54 4.41
122 123 5.480642 ACGCTATGATGATCCAGAGAAAT 57.519 39.130 2.77 0.00 0.00 2.17
164 165 6.940298 TCATCCATTACGAAAAGACTTTCCTT 59.060 34.615 0.00 0.00 38.17 3.36
409 410 1.755621 CGGAGTGGATCATCCCTCTCA 60.756 57.143 20.65 0.00 44.47 3.27
670 671 2.360600 CCCAACCGGCGATTTCCA 60.361 61.111 9.30 0.00 0.00 3.53
1072 1078 8.070034 TCGTTCCAGAACTCCTTAATAATACA 57.930 34.615 8.77 0.00 39.08 2.29
1344 1351 4.646492 AGGCAACCCTTTAGATATTGCTTG 59.354 41.667 7.15 0.00 44.03 4.01
2032 2040 7.062322 AGCCCATTCAAAATATCACACATCTA 58.938 34.615 0.00 0.00 0.00 1.98
2163 2171 0.250513 AGGCTTCTGTCGGATTCACC 59.749 55.000 0.00 0.00 0.00 4.02
2272 2280 1.860641 TAACTAGCCTGCTGCACCTA 58.139 50.000 0.00 1.69 44.83 3.08
2325 2333 7.548780 GCTGGCAAATAAAATTGATAACCTTCA 59.451 33.333 0.00 0.00 31.84 3.02
2340 2348 4.025360 AGTCCATGAATGCTGGCAAATAA 58.975 39.130 0.00 0.00 33.56 1.40
2571 2582 6.119536 AGTAAACATTTCAGTCTGGTGTTCA 58.880 36.000 14.99 3.72 32.32 3.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.